LOC100332270

Ensembl ID:
ENSDARG00000074403
Human Orthologue:
PEX5L
Human Description:
peroxisomal biogenesis factor 5-like [Source:HGNC Symbol;Acc:30024]
Mouse Orthologue:
Pex5l
Mouse Description:
peroxisomal biogenesis factor 5-like Gene [Source:MGI Symbol;Acc:MGI:1916672]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30811 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39752 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108990 Essential Splice Site 258 573 7 13
Genomic Location (Zv9):
Chromosome 2 (position 4495441)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5352883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTGACAGCGAAGGCCTGGTGCCACTCAACTTTTCTCCTACTGAGAAG[G/A]TATTTCCAACCAATCAGAACGCTTTGTTTTATGGTGACTGCCCCCCCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108990 Essential Splice Site 511 573 12 13
Genomic Location (Zv9):
Chromosome 2 (position 4507557)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5364999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCAGATACAACCTCGGCATCAGCTGCATCAACCTGGGGGCACATCGG[T/A]AATAAACTTAATTCCTAAGCAAGTCTCTAATGTGAATTTAAAGGTCCCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Transferability of type 2 diabetes implicated loci in multi-ethnic cohorts from Southeast Asia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link