gnpat

Ensembl ID:
ENSDARG00000074401
ZFIN ID:
ZDB-GENE-040618-4
Human Orthologue:
GNPAT
Human Description:
glyceronephosphate O-acyltransferase [Source:HGNC Symbol;Acc:4416]
Mouse Orthologue:
Gnpat
Mouse Description:
glyceronephosphate O-acyltransferase Gene [Source:MGI Symbol;Acc:MGI:1343460]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19225 Nonsense Mutation detected in F1 DNA During 2016
sa3049 Essential Splice Site Available for shipment Available now
sa32272 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113132 Nonsense 77 671 3 16
Genomic Location:
Chromosome 20 (position 3926774)
KASP Assay ID:
2261-3906.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCCTTGGTGTTTAAACGTTTACTGAACTCTGTGTGCAGGTTTCATCC[G/T]AATCAGGAGACAGCCCTGAGTGCGTTACAGAAGAAGCGTCGCTGATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113132 Essential Splice Site 338 671 8 16
Genomic Location:
Chromosome 20 (position 3915083)
KASP Assay ID:
554-2522.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGGCAGAACGRAAAATAAACCGMTCTCAATACAACCTGCTGCCCAGG[T/C]ATGACACTGCATTCAGCCACGTTCTGCCGTAAAGGCCTTCATCATTCACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa32272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113132 Nonsense 398 671 9 16
Genomic Location:
Chromosome 20 (position 3913507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAACCCCGACGGCCTGGATCTGTCCTCCCTCACAGAACAGACAGACTG[G/A]CTCAGACACCTCGCACTGGCGTTTGGAGCCTTCCTGGACTGGCCTGGTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link