gnpat

Ensembl ID:
ENSDARG00000074401
ZFIN ID:
ZDB-GENE-040618-4
Human Orthologue:
GNPAT
Human Description:
glyceronephosphate O-acyltransferase [Source:HGNC Symbol;Acc:4416]
Mouse Orthologue:
Gnpat
Mouse Description:
glyceronephosphate O-acyltransferase Gene [Source:MGI Symbol;Acc:MGI:1343460]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19225 Nonsense Mutation detected in F1 DNA During 2014
sa3049 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113132 Nonsense 77 671 3 16
Genomic Location:
Chromosome 20 (position 3926774)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCCTTGGTGTTTAAACGTTTACTGAACTCTGTGTGCAGGTTTCATCC[G/T]AATCAGGAGACAGCCCTGAGTGCGTTACAGAAGAAGCGTCGCTGATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113132 Essential Splice Site 338 671 8 16
Genomic Location:
Chromosome 20 (position 3915083)
KASP Assay ID:
554-2522.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGGCAGAACGRAAAATAAACCGMTCTCAATACAACCTGCTGCCCAGG[T/C]ATGACACTGCATTCAGCCACGTTCTGCCGTAAAGGCCTTCATCATTCACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1z6xwbd9