LOC568786

Ensembl ID:
ENSDARG00000074397
Human Orthologue:
BNC1
Human Description:
basonuclin 1 [Source:HGNC Symbol;Acc:1081]
Mouse Orthologue:
Bnc1
Mouse Description:
basonuclin 1 Gene [Source:MGI Symbol;Acc:MGI:1097164]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa645 Nonsense F2 line generated During 2014
sa16236 Nonsense Available for shipment Available now
sa2999 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa645
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109108 Nonsense 63 867 2 4
Genomic Location:
Chromosome 18 (position 79276)
KASP Assay ID:
554-0554.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGCAGCCAGGTGGAGATCKTTCACTCCAATGTGGTATTTGATATCTG[T/A]AGTCTGATGCTTTATGGGACGCAGGCGATCCCAGTGCGTCTGAAGATCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109108 Nonsense 367 867 3 4
Genomic Location:
Chromosome 18 (position 77748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCATCGAGGKCTGCAACATGGTGYTCAGCTCCTTAYGYAGCCGGAAC[C/T]GACACAGCGCCAACCCCAACCCACGGCTGCACATGCCAATGAACCGCAAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109108 Nonsense 487 867 3 4
Genomic Location:
Chromosome 18 (position 77388)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCCTGCCCTCCCTGCCACTGTTGTCCTCCTCTGTGCCCGCCGGCTCC[A/T]GACACATGCTGATGGACACGGTGCCCAAGAAGAAATCTCGCAAGTCCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tknno1qw