fscn2

Ensembl ID:
ENSDARG00000074396
ZFIN ID:
ZDB-GENE-040426-1740
Description:
fascin homolog 2, actin-bundling protein, retinal [Source:RefSeq peptide;Acc:NP_957064]
Human Orthologue:
FSCN2
Human Description:
fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) [Source:HGNC Symbo
Mouse Orthologue:
Fscn2
Mouse Description:
fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) Gene [Source:MGI S

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22154 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111717 Nonsense 33 492 1 5
Genomic Location:
Chromosome 12 (position 36864916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTATTAATCATGAGAATCGCTACCTAACGGCGGAGGCCTTCGGCTTC[A/T]AGGTGAACGCTTCAGCTCCAAGCCTCAAGAAGAAGCAGATCTGGACTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0xcbnfoq