sb:cb1095

Ensembl ID:
ENSDARG00000074393
ZFIN ID:
ZDB-GENE-040128-16
Human Orthologue:
SH3YL1
Human Description:
SH3 domain containing, Ysc84-like 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:29546]
Mouse Orthologue:
Sh3yl1
Mouse Description:
Sh3 domain YSC-like 1 Gene [Source:MGI Symbol;Acc:MGI:1346118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15711 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114137 Nonsense 201 347 6 11
Genomic Location (Zv9):
Chromosome 17 (position 30683852)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30607779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGCTTCTGCTATWCTCAATGGCGATGTAGAACCACCACCTGAAGCCTA[T/A]GATTTGTACACCATTTTACAGGACTAYACTGAGAARTACACWACCGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link