B0V315_DANRE

Ensembl ID:
ENSDARG00000074387
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0V315]
Human Orthologue:
FAM150A
Human Description:
family with sequence similarity 150, member A [Source:HGNC Symbol;Acc:33775]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30901 Nonsense Mutation detected in F1 DNA During 2017
sa41173 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110571 Nonsense 112 151 3 4
ENSDART00000110571 Nonsense 112 151 3 4
Genomic Location (Zv9):
Chromosome 8 (position 18995689)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18440577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGCAACCTTTTTCCCAAGCAGGGCCAGTCAAGTTTCCATCTGAATG[C/A]AGGACACATTTCCACAGAATTTATCACAACACAAGGGATTGTTCCAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110571 Nonsense 112 151 3 4
ENSDART00000110571 Nonsense 112 151 3 4
Genomic Location (Zv9):
Chromosome 8 (position 18995689)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18440577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGCAACCTTTTTCCCAAGCAGGGCCAGTCAAGTTTCCATCTGAATG[C/A]AGGACACATTTCCACAGAATTTATCACAACACAAGGGATTGTTCCAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link