CDH12 (2 of 2)

Ensembl ID:
ENSDARG00000074386
Description:
cadherin 12, type 2 (N-cadherin 2) [Source:HGNC Symbol;Acc:1751]
Human Orthologue:
CDH12
Human Description:
cadherin 12, type 2 (N-cadherin 2) [Source:HGNC Symbol;Acc:1751]
Mouse Orthologue:
Cdh12
Mouse Description:
cadherin 12 Gene [Source:MGI Symbol;Acc:MGI:109503]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22165 Nonsense Mutation detected in F1 DNA During 2014
sa22166 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087449 Nonsense 101 718 2 16
Genomic Location:
Chromosome 12 (position 42124318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGCAGTTTAACAAAAACGAATGTACTCTGTCTATTTGCAGGTACGTA[T/A]GTGATGAAGGTGACGGCAACAGACGCAGATGACCCTACATATGGAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087449 Nonsense 566 718 16 16
Genomic Location:
Chromosome 12 (position 42244163)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTGTGTTTCTTGCAGTGATCGTGGTGCTCTACGTGGGGGTTCGGCGA[C/T]AAAAGAAGAAAGAGACCCTCATGACATCCAAAGAGGACATCCGTGACAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/heghgxv9