si:dkey-101k6.7

Ensembl ID:
ENSDARG00000074384
ZFIN ID:
ZDB-GENE-030131-5654
Description:
solute carrier family 12 member 8 [Source:RefSeq peptide;Acc:NP_001121749]
Human Orthologue:
SLC12A8
Human Description:
solute carrier family 12 (potassium/chloride transporters), member 8 [Source:HGNC Symbol;Acc:15595]
Mouse Orthologue:
Slc12a8
Mouse Description:
solute carrier family 12 (potassium/chloride transporters), member 8 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25433 Nonsense Mutation detected in F1 DNA During 2017
sa2505 Nonsense Available for shipment Available now
sa41489 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110651 Nonsense 123 708 3 13
ENSDART00000133849 Nonsense 123 253 3 6
ENSDART00000135505 Nonsense 77 158 2 3
ENSDART00000135774 Nonsense 112 697 3 13
Genomic Location (Zv9):
Chromosome 9 (position 39699594)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38837490
KASP Assay ID:
554-7521.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCCACTGTGCTGGGAGGCAGGATTGGAGGAACTGTGGGACTCCTGTA[T/A]GTTTTTGGACAGGTGAGCAGCTCGTGCCTGCATTATGTTGCATGTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110651 Nonsense 178 708 4 13
ENSDART00000133849 Nonsense 178 253 4 6
ENSDART00000135505 Nonsense 132 158 3 3
ENSDART00000135774 Nonsense 167 697 4 13
Genomic Location (Zv9):
Chromosome 9 (position 39700069)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38837965
KASP Assay ID:
554-3032.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGCTCGGTCTGCTTGGAATTAATCTGGCCGGGGTCAAATGGATTGTA[C/T]GACTTCAATTGGTTCTGCTTGGGATTTTAGCAATGTCAACTTTGGATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110651 Nonsense 310 708 8 13
ENSDART00000133849   None 253 None 6
ENSDART00000135505   None 158 None 3
ENSDART00000135774 Nonsense 299 697 8 13
Genomic Location (Zv9):
Chromosome 9 (position 39724268)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38862164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCTGTGTTTGTTTTTTTCCCAGGTCTCCTTGGTTGGTTTCCTGTTTT[T/A]GCTGGGCCTCTACATCTCCTCCCTGGCCTCCTGCATGGGCGGCCTGTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link