si:ch211-235f1.1

Ensembl ID:
ENSDARG00000074381
ZFIN IDs:
ZDB-GENE-050522-234, ZDB-GENE-070424-163
Description:
Novel protein similar to vertebrate FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (Chondrocy
Human Orthologue:
FARP1
Human Description:
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Farp1
Mouse Description:
FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) Gene [Source:MGI Symbol;

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38239 Nonsense Mutation detected in F1 DNA During 2017
sa39532 Nonsense Mutation detected in F1 DNA During 2017
sa25509 Nonsense Mutation detected in F1 DNA During 2017
sa9536 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108619   None 1033 None 26
ENSDART00000108919 Nonsense 100 141 3 3
ENSDART00000142944   None 1025 None 27
ENSDART00000143361   None 811 None 13

The following transcripts of ENSDARG00000074381 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 2151427)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 2246847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGAGTTTCAGGATCAGCGGAAAATGATTGTGAGCAACGCTTGTCTTT[T/A]ATTTCAATATGTGAAACATGAGCTACCTCTATACACACAGTACTCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108619 Nonsense 104 1033 3 26
ENSDART00000108919   None 141 3 3
ENSDART00000142944 Nonsense 104 1025 4 27
ENSDART00000143361 Nonsense 104 811 4 13

The following transcripts of ENSDARG00000074381 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 2151758)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 2247178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTGATTCTCTTCTCAGGTGTGGCTGGATCTGCTGAAGCCAATTCTC[A/T]AGCAGATTAGACGTGAGTATACATGTCTGAGTGTTGTTCTGACTGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108619 Nonsense 506 1033 13 26
ENSDART00000108919   None 141 None 3
ENSDART00000142944 Nonsense 502 1025 14 27
ENSDART00000143361   None 811 None 13

The following transcripts of ENSDARG00000074381 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 2177207)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 2272627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGTCCTGACGGACGGCAGCCCTCTCCTCTCACCAGCCCGCTACTATA[C/A]GACGCCGGATTCATCCGCGCAGACGACGAGGACGAGGTTCGGAGGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108619 Essential Splice Site 771 1033 20 26
ENSDART00000108919   None 141 None 3
ENSDART00000142944 Essential Splice Site 763 1025 21 27
ENSDART00000143361   None 811 None 13

The following transcripts of ENSDARG00000074381 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 2188925)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 2284345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATYACTTGACCTTGTCAATCTGTATGTTCACTTGATGTGTTTGTGTGCA[G/A]TTCAGTGATGTTGTGATGTACACGAGTCGAGGATTGACGGCGTCCAATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link