MDGA1

Ensembl ID:
ENSDARG00000074376
Description:
MAM domain containing glycosylphosphatidylinositol anchor 1 [Source:HGNC Symbol;Acc:19267]
Human Orthologue:
MDGA1
Human Description:
MAM domain containing glycosylphosphatidylinositol anchor 1 [Source:HGNC Symbol;Acc:19267]
Mouse Orthologue:
Mdga1
Mouse Description:
MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14556 Essential Splice Site Available for shipment Available now
sa4533 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19070 Nonsense Mutation detected in F1 DNA During 2014
sa11282 Nonsense Available for shipment Available now
sa22373 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Essential Splice Site 537 756 8 11
Genomic Location:
Chromosome 13 (position 44974778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTCAATATTAAACGCAGACTGGCTCAGGTGCAGCTCAACGTGGAGTG[T/A]AAGTGTTTTAAATTGCTACTAGACCAATCTTAAAGTAGYTGGTTATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Essential Splice Site 537 756 9 11
Genomic Location:
Chromosome 13 (position 44960078)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATAAACTYAACAWGTAAACAAGCAGTCTAATAKTCTTTTTGTTTTCACC[A/T]GATCCTCCTGTTGTGGATCCAGTAATGATGGATGTTCGTTCTCCAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Nonsense 569 756 9 11
Genomic Location:
Chromosome 13 (position 44959981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTGCGACGGTCAGTCTCCGCTGTCTGATTCTCAAGTCCAATCCAAAC[C/T]GAATAGTCAGCGCCTACTGGTACCGTAATGGAATACCTTTACGAAACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Nonsense 583 756 9 11
Genomic Location:
Chromosome 13 (position 44959939)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCMAACCGAATAGTCAGCGCCTACTGGTACCGYAATGGAAWACCTTTA[C/T]GMAACTCTCTAGTGGACTCCCAAAATGTCCCTCAGCTCCGCTTCAAAYTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110092 Nonsense 674 756 10 11
Genomic Location:
Chromosome 13 (position 44947999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGCCCGGCGCTGTGGACAAAATCATCGGCTACTGGATCAATGTCCGA[C/T]AGGTACACACACACACCAACGCTGGAAGCTTAATATTTACTGCTTCTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sh3ccgix