elfn1

Ensembl ID:
ENSDARG00000074372
ZFIN ID:
ZDB-GENE-080327-21
Description:
cDNA, clone cssl:d0369 [Source:UniProtKB/TrEMBL;Acc:A8BBD5]
Mouse Orthologue:
Elfn1
Mouse Description:
leucine rich repeat and fibronectin type III, extracellular 1 Gene [Source:MGI Symbol;Acc:MGI:244247

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10220 Nonsense Available for shipment Available now
sa89 Nonsense Available for shipment Available now
sa14916 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111131 Nonsense 57 803 1 1
Genomic Location:
Chromosome 1 (position 8785088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAGGGATTTGWGTGGTTGGCAATTTGCAGCCAGWACCAGCCCCCCTR[T/G]GAAAACATCCCAATGCATATTAAMAGCACAATTKTTGACCTGCGCCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa89
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111131 Nonsense 160 803 1 1
Genomic Location:
Chromosome 1 (position 8785395)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATCTTCAGGCAAACCTGATCGAGACCGTCACAGCCAATGCCTTTTGG[G/T]AATGTCCTGCGATAGAAAACATCGACCTCTCCATGAACAGGATTCAGCAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111131 Nonsense 406 803 1 1
Genomic Location:
Chromosome 1 (position 8786134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCATCTCGACAGGACCAAGGACATTGCAAGAACGTGTGGTAAATGACT[C/A]AACTGCCACTCATTACATTATGACCATCCTTGGGTGTCTCTTTGGGATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8yrre199