tirap

Ensembl ID:
ENSDARG00000074371
ZFIN ID:
ZDB-GENE-040219-4
Description:
MyD88 adaptor-like protein [Source:UniProtKB/TrEMBL;Acc:Q6TQG3]
Human Orthologue:
TIRAP
Human Description:
toll-interleukin 1 receptor (TIR) domain containing adaptor protein [Source:HGNC Symbol;Acc:17192]
Mouse Orthologue:
Tirap
Mouse Description:
toll-interleukin 1 receptor (TIR) domain-containing adaptor protein Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa182 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109673 Nonsense 145 226 2 3
Genomic Location:
Chromosome 18 (position 47495727)
KASP Assay ID:
554-0146.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTRCTGCTCATAACTCCACACTTTCTGAAGGATGATTGGTGTTTGTA[T/A]CAGATGCACCAGGTCCTGTCTGAGGGCCCGATGTCTCAGAGGATWATCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mlbjgmq1