frem2b

Ensembl ID:
ENSDARG00000074369
ZFIN ID:
ZDB-GENE-081119-4
Description:
Fras1 related extracellular matrix protein 2b [Source:RefSeq peptide;Acc:NP_001131133]
Human Orthologue:
FREM2
Human Description:
FRAS1 related extracellular matrix protein 2 [Source:HGNC Symbol;Acc:25396]
Mouse Orthologue:
Frem2
Mouse Description:
Fras1 related extracellular matrix protein 2 Gene [Source:MGI Symbol;Acc:MGI:2444465]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35951 Nonsense Mutation detected in F1 DNA During 2016
sa22690 Nonsense Mutation detected in F1 DNA During 2016
sa12619 Nonsense Available for shipment Available now
sa11529 Nonsense Available for shipment Available now
sa10377 Nonsense Available for shipment Available now
sa42593 Nonsense Mutation detected in F1 DNA During 2016
sa13551 Nonsense Available for shipment Available now
sa39061 Nonsense Mutation detected in F1 DNA During 2016
sa35952 Nonsense Mutation detected in F1 DNA During 2016
sa12519 Nonsense Available for shipment Available now
sa12912 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 680 3116 1 24
Genomic Location (Zv9):
Chromosome 15 (position 33280586)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32735965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATACCATCTCACTTTTTTCCGAAAGAAATTCTTGCGCTACACAGATT[T/A]GGATTCTGACGACAGGGATTTGAAGTACACAATTACCCAACCACCCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 776 3116 1 24
Genomic Location (Zv9):
Chromosome 15 (position 33280873)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32735678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACAGCGCCAGTGGAGTTTTCACCATATTTTTACAGCCTGTGGACAAC[A/T]AACCTCCGCAGATCACCAACACGGGCTTTACTTTGCAAGAACGAGGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 1102 3116 1 24
Genomic Location (Zv9):
Chromosome 15 (position 33281851)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32734700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCAAAGACATTCGGGAAAACCACATTTATTATGTGCAAAGTATTCAT[A/T]AAGGAGTCGAGCCAGTTGAAGATAGGTTTACTTTCAGGTGTTCAGATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 1142 3116 1 24
Genomic Location (Zv9):
Chromosome 15 (position 33281973)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32734578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCCCAATCGTSATAATCCCATCCAATGATGAGAAGCCTGAGATCTA[T/A]ATGAGAGAGTTTGTTGTGATGGAGGGCATGAACATTGTGATTGACACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 1856 3116 5 24
Genomic Location (Zv9):
Chromosome 15 (position 33380908)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32635643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCGATTGAGGAGGATATTGGAGAACTTTTGATTCCTGTGCGAAGATCT[G/T]GAGATGTCAGTCAGGAGCTCATGGTGGTCTGCTTCACACAAYAAGGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 1890 3116 6 24
Genomic Location (Zv9):
Chromosome 15 (position 33382783)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32633768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAGGCACGGTTCCCACTACGGTGCTTTCCTATTCGGACTATATTTCC[C/T]GAGCTGAGGAGCACCACAGTGTGCTGCGTTTCGATAAGGGTGAGACTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 2037 3116 8 24
Genomic Location (Zv9):
Chromosome 15 (position 33405091)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32611460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCGTCAACATGCAGACTTTYAAGGYTACAATCCTGGATGACCTGGGA[C/T]AGCCGGTGCTGGAGGGCCCGGAGAAGTTTGAGCTGGTTCTCCGAATGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 2262 3116 12 24
Genomic Location (Zv9):
Chromosome 15 (position 33411170)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32605381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACATGTGATAAAAATGACAATTTTCTACCTGCAGATGTGGAGTTTAAA[G/T]AGGGAGAGACTGAGCACATCGTGGAGGTAGAGATTCTGTACGATGGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 2346 3116 13 24
Genomic Location (Zv9):
Chromosome 15 (position 33411551)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32605000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTATGATGATACCAGCAGGACTAGAGAAACTCAACCAGCTGCTGGATA[T/A]CCTGTCGTCTGTGTCACGGTGTGTTCACTATATGTAACACTCCTTCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 2653 3116 17 24
ENSDART00000114905 Nonsense 2653 3116 17 24
Genomic Location (Zv9):
Chromosome 15 (position 33421103)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32595448
KASP Assay ID:
2260-8791.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGGCAGCACTTTGACCTGCAGTCTGAGCTGCGTCTCACTTTTGTGTA[T/A]GACACCGCCATCTTGTGGAGAGACGGCATCGGCAGTCCACCAGAGGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 2653 3116 17 24
ENSDART00000114905 Nonsense 2653 3116 17 24
Genomic Location (Zv9):
Chromosome 15 (position 33421103)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32595448
KASP Assay ID:
2260-8791.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGGCAGCACTTTGACCTGCAGTCTGAGCTGCGTCTCACTTTTGTGTA[T/A]GACACCGCCATCTTGTGGAGAGACGGCATCGGCAGTCCACCAGAGGCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link