frem2b

Ensembl ID:
ENSDARG00000074369
ZFIN ID:
ZDB-GENE-081119-4
Description:
Fras1 related extracellular matrix protein 2b [Source:RefSeq peptide;Acc:NP_001131133]
Human Orthologue:
FREM2
Human Description:
FRAS1 related extracellular matrix protein 2 [Source:HGNC Symbol;Acc:25396]
Mouse Orthologue:
Frem2
Mouse Description:
Fras1 related extracellular matrix protein 2 Gene [Source:MGI Symbol;Acc:MGI:2444465]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22690 Nonsense Mutation detected in F1 DNA During 2014
sa12619 Nonsense Available for shipment Available now
sa11529 Nonsense Available for shipment Available now
sa10377 Nonsense Available for shipment Available now
sa7767 Nonsense Mutation detected in F1 DNA During 2014
sa13551 Nonsense Available for shipment Available now
sa4617 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12519 Nonsense Available for shipment Available now
sa12912 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 776 3116 1 24
Genomic Location:
Chromosome 15 (position 33280873)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACAGCGCCAGTGGAGTTTTCACCATATTTTTACAGCCTGTGGACAAC[A/T]AACCTCCGCAGATCACCAACACGGGCTTTACTTTGCAAGAACGAGGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 1102 3116 1 24
Genomic Location:
Chromosome 15 (position 33281851)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCAAAGACATTCGGGAAAACCACATTTATTATGTGCAAAGTATTCAT[A/T]AAGGAGTCGAGCCAGTTGAAGATAGGTTTACTTTCAGGTGTTCAGATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 1142 3116 1 24
Genomic Location:
Chromosome 15 (position 33281973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCCCAATCGTSATAATCCCATCCAATGATGAGAAGCCTGAGATCTA[T/A]ATGAGAGAGTTTGTTGTGATGGAGGGCATGAACATTGTGATTGACACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 1856 3116 5 24
Genomic Location:
Chromosome 15 (position 33380908)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCGATTGAGGAGGATATTGGAGAACTTTTGATTCCTGTGCGAAGATCT[G/T]GAGATGTCAGTCAGGAGCTCATGGTGGTCTGCTTCACACAAYAAGGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 1870 3116 5 24
Genomic Location:
Chromosome 15 (position 33380950)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGATCTGGAGATGTCAGTCAGGAGCTCATGGTGGTCTGCTTCACACAA[C/T]AAGGTGAATTATGAATGATKCTAAAAWTATTYTCATTGGTAACAMTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 2037 3116 8 24
Genomic Location:
Chromosome 15 (position 33405091)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCGTCAACATGCAGACTTTYAAGGYTACAATCCTGGATGACCTGGGA[C/T]AGCCGGTGCTGGAGGGCCCGGAGAAGTTTGAGCTGGTTCTCCGAATGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Essential Splice Site 2195 3116 10 24
Genomic Location:
Chromosome 15 (position 33407259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGGGGCTCAGAATGAGACTCTCGTCAAGATAAAGGACGACGCTGACA[G/T]TAAGACTTTTATCTCACACTGTCTTACATTTCTGTACCCGCTTGTGTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 2653 3116 17 24
ENSDART00000114905 Nonsense 2653 3116 17 24
Genomic Location:
Chromosome 15 (position 33421103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGGCAGCACTTTGACCTGCAGTCTGAGCTGCGTCTCACTTTTGTGTA[T/A]GACACCGCCATCTTGTGGAGAGACGGCATCGGCAGTCCACCAGAGGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114905 Nonsense 2653 3116 17 24
ENSDART00000114905 Nonsense 2653 3116 17 24
Genomic Location:
Chromosome 15 (position 33421103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGGCAGCACTTTGACCTGCAGTCTGAGCTGCGTCTCACTTTTGTGTA[T/A]GACACCGCCATCTTGTGGAGAGACGGCATCGGCAGTCCACCAGAGGCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wka58vjx