GDPD4 (2 of 3)

Ensembl ID:
ENSDARG00000074361
Description:
glycerophosphodiester phosphodiesterase domain containing 4 [Source:HGNC Symbol;Acc:24849]
Human Orthologue:
GDPD4
Human Description:
glycerophosphodiester phosphodiesterase domain containing 4 [Source:HGNC Symbol;Acc:24849]
Mouse Orthologue:
Gdpd4
Mouse Description:
glycerophosphodiester phosphodiesterase domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:3606573]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36567 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113963 Nonsense 331 411 8 10
Genomic Location (Zv9):
Chromosome 18 (position 6694908)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3200745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTCTCTGCTTCCTTCACACAGACTCCAGATCAGTACAATCTGATGTG[G/A]ATCCTCACCATTATCGTCTCTGCTTTCTTCATCACCGCTGTTTTCATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link