CPXM1 (1 of 2)

Ensembl ID:
ENSDARG00000074358
Description:
carboxypeptidase X (M14 family), member 1 [Source:HGNC Symbol;Acc:15771]
Human Orthologue:
CPXM1
Human Description:
carboxypeptidase X (M14 family), member 1 [Source:HGNC Symbol;Acc:15771]
Mouse Orthologue:
Cpxm1
Mouse Description:
carboxypeptidase X 1 (M14 family) Gene [Source:MGI Symbol;Acc:MGI:1934569]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35770 Nonsense Available for shipment Available now
sa28373 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114684 Nonsense 87 975 1 14
Genomic Location (Zv9):
Chromosome 14 (position 53673531)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 51607905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTACTGCAGACTACACCACCAGCAGAAGAAGAGCTCAGGAACACAGC[A/T]GACTACACAACAGCACACACGGTCTGTACACAGCTGCTGCTGGAATACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114684 Nonsense 370 975 4 14
Genomic Location (Zv9):
Chromosome 14 (position 53678604)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 51612978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTCTGCAGTCTGGTGTGGAGGATGGAGATATCTATGACGGAGGCTG[G/A]TGTGCGCAGTATGAAGACCAGCAACAGTGGCTGCAGATCCATGCCCAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link