LOC100330316

Ensembl ID:
ENSDARG00000074357
Human Orthologue:
BICD1
Human Description:
bicaudal D homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:1049]
Mouse Orthologue:
Bicd1
Mouse Description:
bicaudal D homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1101760]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20182 Nonsense Mutation detected in F1 DNA During 2014
sa12371 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113062 Nonsense 244 846 4 9
Genomic Location:
Chromosome 4 (position 3142218)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAGAGCCAATTAGAGGAGGCGTTGGATGCCCTGAAAAACGAGCGCGAG[C/T]AGAAAAACATTTTGCGTAAAGAATTAGCCCACCATCTAACCGTGTGCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113062 Nonsense 814 846 9 9
Genomic Location:
Chromosome 4 (position 3134183)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAACTGGCCCTCACGCAGAAACTGGAGGACCTGGAGTTCGACCAGGAG[C/T]AGACACACCGCAYCCGAGTGGGAAAACCMTCCCGTATGAGGAGCAGCACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/egpd7ybq