fxn

Ensembl ID:
ENSDARG00000074356
ZFIN ID:
ZDB-GENE-070209-286
Description:
frataxin, mitochondrial [Source:RefSeq peptide;Acc:NP_001076485]
Human Orthologue:
FXN
Human Description:
frataxin [Source:HGNC Symbol;Acc:3951]
Mouse Orthologue:
Fxn
Mouse Description:
frataxin Gene [Source:MGI Symbol;Acc:MGI:1096879]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34315 Nonsense Mutation detected in F1 DNA During 2016
sa11321 Essential Splice Site Available for shipment Available now
sa16490 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113008   None 169 1 6
ENSDART00000142577 Nonsense 25 200 1 6
Genomic Location (Zv9):
Chromosome 8 (position 11381395)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11287729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTCGTTTGTATCAACTGAGCTTGAGCTCCAGATGGAAATGTTACCAA[C/T]AAATCTCCAGACTGTCAACAATGAGCAGTGGACTTAATGTAGGTGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113008 Essential Splice Site 6 169 None 6
ENSDART00000142577 Essential Splice Site 37 200 None 6
Genomic Location (Zv9):
Chromosome 8 (position 11381355)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11287769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTACCAACAAATCTCCAGACTGTCAACAAYGAGCAGTGGACTTAATG[T/C]AGGTGAAGTTAAAACAAACATCTCTGACTGGTTAGCATGAATGGATTNNNNNNCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113008 Nonsense 58 169 4 6
ENSDART00000142577 Nonsense 89 200 4 6
Genomic Location (Zv9):
Chromosome 8 (position 11377229)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11291895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACTATTGCAATGRTTGTTTTGTATAGAGAAATATCAGAGGCCGAGTA[T/A]GAGAGACTAGCAGAAGAGACGCTGGATGCATTAGCAGATTATTTTGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link