fxn

Ensembl ID:
ENSDARG00000074356
ZFIN ID:
ZDB-GENE-070209-286
Description:
frataxin, mitochondrial [Source:RefSeq peptide;Acc:NP_001076485]
Human Orthologue:
FXN
Human Description:
frataxin [Source:HGNC Symbol;Acc:3951]
Mouse Orthologue:
Fxn
Mouse Description:
frataxin Gene [Source:MGI Symbol;Acc:MGI:1096879]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11321 Essential Splice Site Available for shipment Available now
sa16490 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113008 Essential Splice Site 6 169 None 6
ENSDART00000142577 Essential Splice Site 37 200 None 6
Genomic Location:
Chromosome 8 (position 11381355)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTACCAACAAATCTCCAGACTGTCAACAAYGAGCAGTGGACTTAATG[T/C]AGGTGAAGTTAAAACAAACATCTCTGACTGGTTAGCATGAATGGATTNNNNNNCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113008 Nonsense 58 169 4 6
ENSDART00000142577 Nonsense 89 200 4 6
Genomic Location:
Chromosome 8 (position 11377229)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACTATTGCAATGRTTGTTTTGTATAGAGAAATATCAGAGGCCGAGTA[T/A]GAGAGACTAGCAGAAGAGACGCTGGATGCATTAGCAGATTATTTTGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e6xsmd1k