serf2

Ensembl ID:
ENSDARG00000074340
ZFIN ID:
ZDB-GENE-041108-1
Description:
small EDRK-rich factor 2 [Source:RefSeq peptide;Acc:NP_001153807]
Human Orthologues:
SERF1A, SERF1B
Human Descriptions:
small EDRK-rich factor 1A (telomeric) [Source:HGNC Symbol;Acc:10755]
small EDRK-rich factor 1B (centromeric) [Source:HGNC Symbol;Acc:10756]
Mouse Orthologues:
Serf1, Serf2
Mouse Descriptions:
small EDRK-rich factor 1 Gene [Source:MGI Symbol;Acc:MGI:1337114]
small EDRK-rich factor 2 Gene [Source:MGI Symbol;Acc:MGI:1337041]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34094 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125138 Essential Splice Site 3 53 2 4
ENSDART00000126741 Essential Splice Site 3 60 2 3
Genomic Location (Zv9):
Chromosome 7 (position 31615769)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30008111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAAGTGTTTTTGATTTTAAGTAAATTAAGTAAATTTGTCATCCTGCA[G/A]GGGGAAATCAGCGTGAGCTTGCCCGCCAAAAGAACGCTAAGAAGCAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link