cbfa2t2

Ensembl ID:
ENSDARG00000074337
ZFIN IDs:
ZDB-GENE-060929-236, ZDB-GENE-070209-1
Description:
hypothetical protein LOC767652 [Source:RefSeq peptide;Acc:NP_001070060]
Human Orthologue:
CBFA2T2
Human Description:
core-binding factor, runt domain, alpha subunit 2; translocated to, 2 [Source:HGNC Symbol;Acc:1536]
Mouse Orthologue:
Cbfa2t2
Mouse Description:
core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI Symbo

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5392 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083807 Nonsense 412 568 8 10
Genomic Location:
Chromosome 6 (position 57588536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCCGCAGACTCTCCGAGGGACGTTCCCCTGCGCGCATCCTCTGGATA[C/A]GTGCCTGATGAGATCTGGAGGAAAGCCGGTGAGGGCAGAGACCCAGATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qljjsmlm