cbfa2t2

Ensembl ID:
ENSDARG00000074337
ZFIN IDs:
ZDB-GENE-060929-236, ZDB-GENE-070209-1
Description:
hypothetical protein LOC767652 [Source:RefSeq peptide;Acc:NP_001070060]
Human Orthologue:
CBFA2T2
Human Description:
core-binding factor, runt domain, alpha subunit 2; translocated to, 2 [Source:HGNC Symbol;Acc:1536]
Mouse Orthologue:
Cbfa2t2
Mouse Description:
core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI Symbo

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33986 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33985 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5392 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083807 Essential Splice Site 50 568 1 10
Genomic Location:
Chromosome 6 (position 57604960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGTCAACCCCAGCGGACCTCGTCCCGCAGCCTTCTCCACTACTGCAT[G/A]TGAGACTCACACACACACTTGTATAGCTATCTTTATGGGGACTTCTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083807 Essential Splice Site 329 568 6 10
Genomic Location:
Chromosome 6 (position 57592090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACTGACGGAGAGAGAGTGGGCTGAGGAATGGAGACATCTGGATCATG[T/A]AAGTCTACGCTTATGGAGAATCTGCTAACATCTTTAAAGAGCCATGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083807 Nonsense 412 568 8 10
Genomic Location:
Chromosome 6 (position 57588536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCCGCAGACTCTCCGAGGGACGTTCCCCTGCGCGCATCCTCTGGATA[C/A]GTGCCTGATGAGATCTGGAGGAAAGCCGGTGAGGGCAGAGACCCAGATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link