boc

Ensembl ID:
ENSDARG00000074335
ZFIN IDs:
ZDB-GENE-030131-6560, ZDB-GENE-030131-6560
Description:
brother of CDO [Source:RefSeq peptide;Acc:NP_001005393]
Human Orthologue:
BOC
Human Description:
Boc homolog (mouse) [Source:HGNC Symbol;Acc:17173]
Mouse Orthologue:
Boc
Mouse Description:
biregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein Gene [S

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44130 Nonsense Mutation detected in F1 DNA During 2017
sa37880 Nonsense Available for shipment Available now
sa37879 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111025 Nonsense 336 1032 7 19
ENSDART00000115000 Nonsense 336 1032 6 18
Genomic Location (Zv9):
Chromosome 24 (position 21831244)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21078373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACTTCTCTTGTGTTTCAGAGCCTCCTCAGGTGCGTGTGGAGCTGCAG[C/T]AGCAGGACGTGGCGTGGGGGGATACAGTGCGCTTCAGCTGTCAGGTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111025 Nonsense 458 1032 8 19
ENSDART00000115000 Nonsense 458 1032 7 18
Genomic Location (Zv9):
Chromosome 24 (position 21829153)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21076282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCACCAGTGTCCACCAGTGCGGTGCTGCCCTTCGACTGCTCTGAAGTA[C/T]GAGTCTCTCCTGCTGAAGCTCCAGTCATTCTCAGTCAGCCGCGCACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111025 Nonsense 528 1032 9 19
ENSDART00000115000 Nonsense 528 1032 8 18
Genomic Location (Zv9):
Chromosome 24 (position 21827628)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21074757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCAACACTATTTCAGGGTCTCAGCACAAGCTCATACTAACCAAACTG[C/T]AGCCTGCCAGCCTCTATGAAGTGGAAATGGCTGCTAGGAACTGTGCTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link