ENSDARG00000074334

Ensembl ID:
ENSDARG00000074334
Human Orthologues:
CD300A, CD300C, CD300E, CD300LB, CD300LD, CD300LF
Human Descriptions:
CD300 molecule-like family member b [Source:HGNC Symbol;Acc:30811]
CD300 molecule-like family member d [Source:HGNC Symbol;Acc:16848]
CD300 molecule-like family member f [Source:HGNC Symbol;Acc:29883]
CD300a molecule [Source:HGNC Symbol;Acc:19319]
CD300c molecule [Source:HGNC Symbol;Acc:19320]
CD300e molecule [Source:HGNC Symbol;Acc:28874]
Mouse Orthologues:
AF251705, Cd300a, Cd300c, Cd300e, Cd300lb, Cd300ld, Cd300lf, Clm3, Gm11709, Gm11709, Gm11711
Mouse Descriptions:
CD300 antigen like family member B Gene [Source:MGI Symbol;Acc:MGI:2685099]
CD300 antigen like family member F Gene [Source:MGI Symbol;Acc:MGI:2442359]
CD300 molecule-like family member d Gene [Source:MGI Symbol;Acc:MGI:2442358]
CD300A antigen Gene [Source:MGI Symbol;Acc:MGI:2443411]
CD300C antigen Gene [Source:MGI Symbol;Acc:MGI:3032626]
CD300e antigen Gene [Source:MGI Symbol;Acc:MGI:2387602]
cDNA sequence AF251705 Gene [Source:MGI Symbol;Acc:MGI:2153249]
CMRF-35-like molecule 3 Gene [Source:MGI Symbol;Acc:MGI:2687214]
predicted gene 11709 Gene [Source:MGI Symbol;Acc:MGI:3649405]
predicted gene 11709 Gene [Source:MGI Symbol;Acc:MGI:3649405]
predicted gene 11711 Gene [Source:MGI Symbol;Acc:MGI:3702661]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32800 Nonsense Mutation detected in F1 DNA During 2016
sa25707 Nonsense Mutation detected in F1 DNA During 2016
sa19625 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112472 Nonsense 150 524 5 12
Genomic Location:
Chromosome 1 (position 58443006)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTGTTCAGATCAGTAATATGAGTAAAGCAGGAGCTGTTTGTAAGGGT[G/T]AATGTGCTCTTTTAAGACGTCTTGAAGAGGTGAGAGAGATGAAGATACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112472 Nonsense 253 524 6 12
Genomic Location:
Chromosome 1 (position 58443426)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACAGCTTCAGGACACAGAGGAGAGAAACTGGACATCAGATGCTCATA[T/A]GAGTCTGGATATGAGTCAAACTCAAAGTATTTCTGTAAGGGCAAGTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112472 Nonsense 327 524 6 12
Genomic Location:
Chromosome 1 (position 58443648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAAGGACAATACTGGTGTGCTGTGGAGAAGAGTGTATTTGATGTCTA[T/A]TCAGAGATTGTGCTGATGGTCAAACAGGGTAAGGGATCTATTTTAATGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Fibrinogen: Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link