si:dkey-1a7.2

Ensembl ID:
ENSDARG00000074331
ZFIN ID:
ZDB-GENE-090312-49
Human Orthologue:
EIF4G3
Human Description:
eukaryotic translation initiation factor 4 gamma, 3 [Source:HGNC Symbol;Acc:3298]
Mouse Orthologue:
Eif4g3
Mouse Description:
eukaryotic translation initiation factor 4 gamma, 3 Gene [Source:MGI Symbol;Acc:MGI:1923935]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13948 Nonsense Available for shipment Available now
sa15649 Essential Splice Site Available for shipment Available now
sa24317 Nonsense Available for shipment Available now
sa18232 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087110 Nonsense 274 1700 8 34
ENSDART00000145172 Nonsense 198 1624 6 32

The following transcripts of ENSDARG00000074331 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 22316355)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22095662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAYGGAATTTKTCTTGTATGTTTTATSAGCAGCAGGACCTCCCTACTA[T/A]CCTGGGCAGCCCGTGTACACACCATCTCCACCCATYATAGTGCCTACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087110 Essential Splice Site 303 1700 None 34
ENSDART00000145172 Essential Splice Site 227 1624 None 32

The following transcripts of ENSDARG00000074331 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 22316444)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22095751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCCTACACCACAACAACCTCCACCYGCTAAGAGGGAAAAGAAAACAG[T/C]GAGTCTACATTAACTTATTGTTCTGCATCGTCTTTTGCCACAGAGTTTAM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087110 Nonsense 1491 1700 30 34
ENSDART00000145172 Nonsense 1415 1624 28 32

The following transcripts of ENSDARG00000074331 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 22348811)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22128118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTGTATGTTTTCTGTATGCAGAGCCATAAGAAAGTGGGATCATTATG[G/A]AGGGATTCTGGGTTGAGCTGGGCAGATTTTATACCTGAAACAGAGGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087110 Nonsense 1642 1700 34 34
ENSDART00000145172 Nonsense 1566 1624 32 32

The following transcripts of ENSDARG00000074331 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 22353811)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22133118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAATGGGTTAAAAATKAATGATWWATCTTTGTATCTTTATTGCAGATT[T/A]GCTCCGGATGTTTTTTGACTGTTTGTATGATGAGGACGTGATCTCTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link