arvcfa

Ensembl ID:
ENSDARG00000074329
ZFIN ID:
ZDB-GENE-091113-43
Human Orthologue:
ARVCF
Human Description:
armadillo repeat gene deleted in velocardiofacial syndrome [Source:HGNC Symbol;Acc:728]
Mouse Orthologue:
Arvcf
Mouse Description:
armadillo repeat gene deleted in velo-cardio-facial syndrome Gene [Source:MGI Symbol;Acc:MGI:109620]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18632 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113728 Essential Splice Site 697 819 12 16
ENSDART00000145220 Essential Splice Site 649 771 9 14
Genomic Location:
Chromosome 10 (position 502085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATCCAGGGACAGGGCATYCAGAAACTGGTGTCAATCAACAGAACAAG[G/A]TGACCACCTGGCAACAAACACCATAGCAACARCATACAACACTATAACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/buldan22