apba1

Ensembl ID:
ENSDARG00000074328
ZFIN ID:
ZDB-GENE-070925-3
Human Orthologue:
APBA1
Human Description:
amyloid beta (A4) precursor protein-binding, family A, member 1 [Source:HGNC Symbol;Acc:578]
Mouse Orthologue:
Apba1
Mouse Description:
amyloid beta (A4) precursor protein binding, family A, member 1 Gene [Source:MGI Symbol;Acc:MGI:1860

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11155 Nonsense Available for shipment Available now
sa41608 Nonsense Mutation detected in F1 DNA During 2016
sa11749 Nonsense Available for shipment Available now
sa41609 Nonsense Mutation detected in F1 DNA During 2016
sa41610 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114483 Nonsense 83 971 1 12
ENSDART00000140511 Nonsense 83 960 2 12

The following transcripts of ENSDARG00000074328 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 15812245)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTCGAGCTCCACCRCGTCATCGTAGGCGGCATGTTCCTGGTCAAGCA[C/T]AACGCAGGCGGCCCGAGAGTGGAGATTCAGAAGCTAGAGCTGGCCAGCAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114483 Nonsense 124 971 1 12
ENSDART00000140511 Nonsense 124 960 2 12

The following transcripts of ENSDARG00000074328 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 15812368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATCGAAGTGGAGAGAGACTCTATCAGCACAGATACAGACAACAGCAC[A/T]AAGATGAAGAACAACATGTCAAAACTCCTCCAAAAGAGCAAGCTTCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114483 Nonsense 275 971 1 12
ENSDART00000140511 Nonsense 275 960 2 12

The following transcripts of ENSDARG00000074328 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 15812821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCACATCTCCTCACCAGATTATCAACAAACCTTTTTTTCAGTCTCCA[C/T]GAAGCTTCCCTGAGAGTCTTCGAAGGTACAATTCTGATCCGAAGTCATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114483 Nonsense 329 971 1 12
ENSDART00000140511 Nonsense 329 960 2 12

The following transcripts of ENSDARG00000074328 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 15812985)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCACGATGAAGGTGACCTCTCAGACTCTGAAGCCTATACAGATTCTTA[C/G]CCAGAGTCTCATCCTAAAGACACAGAAACAGACCTTAACCCAGCCTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114483 Essential Splice Site 861 971 9 12
ENSDART00000140511 Essential Splice Site 850 960 9 12

The following transcripts of ENSDARG00000074328 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 15831913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCAGTTTGGTCGGACTGCCGCTCTCCACCTGCCAGAGCATCATTAAA[G/A]TATGGCTCGCTTCTTTTGCTAAATTTATTTGACATTTTTAACTTTTAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link