apba1

Ensembl ID:
ENSDARG00000074328
ZFIN ID:
ZDB-GENE-070925-3
Human Orthologue:
APBA1
Human Description:
amyloid beta (A4) precursor protein-binding, family A, member 1 [Source:HGNC Symbol;Acc:578]
Mouse Orthologue:
Apba1
Mouse Description:
amyloid beta (A4) precursor protein binding, family A, member 1 Gene [Source:MGI Symbol;Acc:MGI:1860

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11155 Nonsense Available for shipment Available now
sa11749 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114483 Nonsense 83 971 1 12
ENSDART00000140511 Nonsense 83 960 2 12

The following transcripts of ENSDARG00000074328 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 15812245)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTCGAGCTCCACCRCGTCATCGTAGGCGGCATGTTCCTGGTCAAGCA[C/T]AACGCAGGCGGCCCGAGAGTGGAGATTCAGAAGCTAGAGCTGGCCAGCAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114483 Nonsense 275 971 1 12
ENSDART00000140511 Nonsense 275 960 2 12

The following transcripts of ENSDARG00000074328 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 15812821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCACATCTCCTCACCAGATTATCAACAAACCTTTTTTTCAGTCTCCA[C/T]GAAGCTTCCCTGAGAGTCTTCGAAGGTACAATTCTGATCCGAAGTCATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nyvslvv5