LOC100333576

Ensembl ID:
ENSDARG00000074326
Human Orthologue:
MCM8
Human Description:
minichromosome maintenance complex component 8 [Source:HGNC Symbol;Acc:16147]
Mouse Orthologue:
Mcm8
Mouse Description:
minichromosome maintenance deficient 8 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913884]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4689 Nonsense Mutation detected in F1 DNA During 2014
sa10066 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114691 Nonsense 58 852 1 18
Genomic Location:
Chromosome 17 (position 4095794)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGRGAGGCCGTCAGTGGAGTNNNNNNGGAGGAGGARGAGGAAGAGGAAACTA[T/G]TCAAACAACAATACACAAAAGGGTTAGTAGCATTAGTCAMGATWCATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114691 Nonsense 113 852 3 18
Genomic Location:
Chromosome 17 (position 4098953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTTTTGTTGAAAGTTCACCTTATGTTGAGAAAATAAAGGTGTTTGAG[C/T]AGTACTTCACATCACAGATCGATCTTTATGATAAGGTATTTAAAAGGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xtf1prg9