LOC100333576

Ensembl ID:
ENSDARG00000074326
Human Orthologue:
MCM8
Human Description:
minichromosome maintenance complex component 8 [Source:HGNC Symbol;Acc:16147]
Mouse Orthologue:
Mcm8
Mouse Description:
minichromosome maintenance deficient 8 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913884]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4689 Nonsense Mutation detected in F1 DNA During 2016
sa10066 Nonsense Available for shipment Available now
sa36290 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114691 Nonsense 58 852 1 18
Genomic Location:
Chromosome 17 (position 4095794)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGRGAGGCCGTCAGTGGAGTNNNNNNGGAGGAGGARGAGGAAGAGGAAACTA[T/G]TCAAACAACAATACACAAAAGGGTTAGTAGCATTAGTCAMGATWCATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114691 Nonsense 113 852 3 18
Genomic Location:
Chromosome 17 (position 4098953)
KASP Assay ID:
2261-0509.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTTTTGTTGAAAGTTCACCTTATGTTGAGAAAATAAAGGTGTTTGAG[C/T]AGTACTTCACATCACAGATCGATCTTTATGATAAGGTATTTAAAAGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114691 Nonsense 447 852 11 18
Genomic Location:
Chromosome 17 (position 4113354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTTAAAGCTGGGTTGGCTCTGGCTCTGTTTGGAGGATGTCAGAAGTA[T/A]GTTGATGATAAAAACCGTATCCCGATAAGAGGAGACCCGCATATGCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link