efcab2

Ensembl ID:
ENSDARG00000074323
ZFIN ID:
ZDB-GENE-070521-5
Human Orthologue:
EFCAB2
Human Description:
EF-hand calcium binding domain 2 [Source:HGNC Symbol;Acc:28166]
Mouse Orthologue:
Efcab2
Mouse Description:
EF-hand calcium binding domain 2 Gene [Source:MGI Symbol;Acc:MGI:1915476]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6142 Essential Splice Site Mutation detected in F1 DNA During 2015
sa31010 Essential Splice Site Mutation detected in F1 DNA During 2015
sa11337 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113669 Essential Splice Site 41 168 3 7
Genomic Location:
Chromosome 17 (position 11364595)
KASP Assay ID:
554-3693.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTCTACAAACAAGGAAGACTTCTTTAATGTTRTCTGTCATTTTTCAC[C/T]GTAAAAGGGAAATAGGCACCATCATTCGTTCACTTGGCTGTTTTCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113669 Essential Splice Site 130 168 6 7
Genomic Location:
Chromosome 17 (position 11367085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGGACACCTGGAACCAGCAGAACTGGCCAAATACTTAACACAAGAAG[G/A]TGAGACTATAACAAAGTGTTGTCCTGGATTTTAAGATTCTTCCAATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113669 Nonsense 156 168 7 7
Genomic Location:
Chromosome 17 (position 11368350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAAATGCTGTCTGCTGCTGTTGATCCTGWTAAAAATGTCATTTTCTA[C/A]AAGGACTTTGTGAGCATGATGACTTATDATGACACCCGATAATCAAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g6cvkzgq