efcab2

Ensembl ID:
ENSDARG00000074323
ZFIN ID:
ZDB-GENE-070521-5
Human Orthologue:
EFCAB2
Human Description:
EF-hand calcium binding domain 2 [Source:HGNC Symbol;Acc:28166]
Mouse Orthologue:
Efcab2
Mouse Description:
EF-hand calcium binding domain 2 Gene [Source:MGI Symbol;Acc:MGI:1915476]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6142 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11337 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113669 Essential Splice Site 41 168 3 7
Genomic Location:
Chromosome 17 (position 11364595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTCTACAAACAAGGAAGACTTCTTTAATGTTRTCTGTCATTTTTCAC[C/T]GTAAAAGGGAAATAGGCACCATCATTCGTTCACTTGGCTGTTTTCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113669 Nonsense 156 168 7 7
Genomic Location:
Chromosome 17 (position 11368350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAAATGCTGTCTGCTGCTGTTGATCCTGWTAAAAATGTCATTTTCTA[C/A]AAGGACTTTGTGAGCATGATGACTTATDATGACACCCGATAATCAAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g6cvkzgq