LOC100333441

Ensembl ID:
ENSDARG00000074321
Human Orthologue:
TEAD3
Human Description:
TEA domain family member 3 [Source:HGNC Symbol;Acc:11716]
Mouse Orthologue:
Tead3
Mouse Description:
TEA domain family member 3 Gene [Source:MGI Symbol;Acc:MGI:109241]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16238 Essential Splice Site Available for shipment Available now
sa14593 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083622 Essential Splice Site 44 384 3 12
Genomic Location:
Chromosome 23 (position 5671321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTCTTTTTTNCCTCTTTGCTCCCTCGCTCCTCTGATGTTCCTCCTGC[A/G]GGTGTCTAGTCATCTGCAGGTTCTTGCGCGGAGAAAGTCTCGCGAGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083622 Essential Splice Site 126 384 6 12
Genomic Location:
Chromosome 23 (position 5665264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGTTTTGGCCCGGCCCCATCCCAGGACAGCCTGGACCTTCTCAGGAG[T/G]GAGTATTTCAGACCCACATTTGATCTAAGAACAGTACTCCTGCAATGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vefljktk