sall1a

Ensembl ID:
ENSDARG00000074319
ZFIN ID:
ZDB-GENE-020228-2
Description:
sal-like protein 1 [Source:RefSeq peptide;Acc:NP_001139486]
Human Orthologue:
SALL1
Human Description:
sal-like 1 (Drosophila) [Source:HGNC Symbol;Acc:10524]
Mouse Orthologue:
Sall1
Mouse Description:
sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38627 Nonsense Mutation detected in F1 DNA During 2017
sa11237 Nonsense Available for shipment Available now
sa40952 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111842 Nonsense 239 1313 2 3
Genomic Location (Zv9):
Chromosome 7 (position 38776441)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37113081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCCCTCATGGAGCAGCTCTTGGCCCTGCAGCAGCAGCAGATTCAC[C/T]AGCTACAGCTCATAGAGCAGATTCGTCACCAGATTCTTCTGTTAGCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111842 Nonsense 241 1313 2 3
Genomic Location (Zv9):
Chromosome 7 (position 38776447)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37113087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCATGGAGCAGCTCTTGGCCCTGCAGCAGCAGCAGATTCACCAGCTA[C/T]AGCTCATAGAGCAGATTCGTCACCAGATTCTTCTGTTAGCCTCACAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111842 Nonsense 1215 1313 3 3
Genomic Location (Zv9):
Chromosome 7 (position 38781394)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37118034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTGTTAAGTTTCCTGAGCTCTTCCAAAAGGACCTATCCAGCAGGGCT[G/T]GAAACGGAGACCCAACCAGCTTCTGGAATCAGTATGCTGCTGCTTTCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link