LOC792520

Ensembl ID:
ENSDARG00000074317
Human Orthologue:
FAM20C
Human Description:
family with sequence similarity 20, member C [Source:HGNC Symbol;Acc:22140]
Mouse Orthologue:
Fam20c
Mouse Description:
family with sequence similarity 20, member C Gene [Source:MGI Symbol;Acc:MGI:2136853]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11878 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113524 Nonsense 438 560 8 10
Genomic Location:
Chromosome 3 (position 62621495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTCTCTGWTTTTGCACTGAACAGGCWACATGGACCGCCATCAYTA[C/A]GAAACTTTYGAGAAGTTTGGAAACGACACTTTCATCATTCATTTGGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cordgtkh