LOC100332172

Ensembl ID:
ENSDARG00000074314
Human Orthologue:
TTC37
Human Description:
tetratricopeptide repeat domain 37 [Source:HGNC Symbol;Acc:23639]
Mouse Orthologue:
Ttc37
Mouse Description:
tetratricopeptide repeat domain 37 Gene [Source:MGI Symbol;Acc:MGI:2679923]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12559 Nonsense Available for shipment Available now
sa2213 Essential Splice Site F2 line generated During 2016
sa40552 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33706 Nonsense Mutation detected in F1 DNA During 2016
sa33705 Nonsense Mutation detected in F1 DNA During 2016
sa33704 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31475 Essential Splice Site Available for shipment Available now
sa18177 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Nonsense 40 1577 2 40
Genomic Location (Zv9):
Chromosome 5 (position 52554320)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50221516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCTATTTCTCCACTTCAGGCTGTTCTAAAGCTTGAGAAGAATAACTA[T/G]AATGCCTGGGTGTTTATTGGAGTGGCAGCCACAGAGCTCCAGCAGCCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2213
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Essential Splice Site 184 1577 5 40
Genomic Location (Zv9):
Chromosome 5 (position 52552789)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50219985
KASP Assay ID:
554-2695.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCCTGCAGGACACTGTTGACGACCAGGACAATGAAACACAGCAGCAC[G/A]TCAGAATTTCTCATATTCAAATAAAATACTCTATTTTTTCACCCAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Essential Splice Site 300 1577 8 40
Genomic Location (Zv9):
Chromosome 5 (position 52548766)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50215962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTGTCAGGATAAAAAATATGAGGATGCCATCAAAAATATTGGTCTGG[G/A]TAAGTTCATAAACACTCAGATGTTCATGAATGAATGGAGCACTAAGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Nonsense 471 1577 13 40
Genomic Location (Zv9):
Chromosome 5 (position 52545177)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50212373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTTCTTCCTGCTCGGGTCCCTTTATTGGAACATGGGAGAGGAAATA[C/T]GAAGAGACCGCAGCAAAACTCATTTACTCAAAGTGAGACACTTTAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Nonsense 788 1577 19 40
Genomic Location (Zv9):
Chromosome 5 (position 52535251)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50202447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGATGCCAGAAGCTCCCAGTCTGTGGTGTGACCTGGGTTTGAACTA[T/G]TACCATCAATCCAGACTGCTCAGCTCTCATTATCCTGAGGAGGATCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Essential Splice Site 839 1577 20 40
Genomic Location (Zv9):
Chromosome 5 (position 52535006)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50202202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAATCACACATACTGGAATGCCCTCGGGGTGGTAGCCATGACAAAGG[G/A]TAAACACAATCAGATGTGCATAATCGAATTAATCTGCATTACATAACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Essential Splice Site 1009 1577 26 40
Genomic Location (Zv9):
Chromosome 5 (position 52530500)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50197696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACACACACCTGCAGCTCAGGAAACAGGCCACTGAGGCTTATCACAGG[T/C]TTGCCCTTTCTAGCTAATTACACATGTCAAAAAAGATAATTAGGCTACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Essential Splice Site 1509 1577 38 40
Genomic Location (Zv9):
Chromosome 5 (position 52507193)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50174389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCCTTTTTCAAGCCTTACTGCAGTTCTCCGTGAAGATGGGYGCCAG[G/T]TAGARGACTTTAAAAATAGAGCTCTTTTGTGTTTSTGTTGTATTAATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link