LOC100332172

Ensembl ID:
ENSDARG00000074314
Human Orthologue:
TTC37
Human Description:
tetratricopeptide repeat domain 37 [Source:HGNC Symbol;Acc:23639]
Mouse Orthologue:
Ttc37
Mouse Description:
tetratricopeptide repeat domain 37 Gene [Source:MGI Symbol;Acc:MGI:2679923]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12559 Nonsense Available for shipment Available now
sa2213 Essential Splice Site F2 line generated During 2014
sa3560 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2256 Nonsense Mutation detected in F1 DNA During 2014
sa5318 Nonsense Mutation detected in F1 DNA During 2014
sa18177 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Nonsense 40 1577 2 40
Genomic Location:
Chromosome 5 (position 52554320)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCTATTTCTCCACTTCAGGCTGTTCTAAAGCTTGAGAAGAATAACTA[T/G]AATGCCTGGGTGTTTATTGGAGTGGCAGCCACAGAGCTCCAGCAGCCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2213
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Essential Splice Site 184 1577 5 40
Genomic Location:
Chromosome 5 (position 52552789)
KASP Assay ID:
554-2695.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCCTGCAGGACACTGTTGACGACCAGGACAATGAAACACAGCAGCAC[G/A]TCAGAATTTCTCATATTCAAATAAAATACTCTATTTTTTCACCCAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Essential Splice Site 406 1577 11 40
Genomic Location:
Chromosome 5 (position 52545838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGGAAGAGCTTACTTGGAAAAAGGCCAGACGGAGGAAGCATTTCAGG[T/C]AAAMAGAACTGCATTCCTAATGTTTTTTNATCTATTTATTAAAACAATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Nonsense 434 1577 12 40
Genomic Location:
Chromosome 5 (position 52545383)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTGTGGATGGTCTCACTTTGAAAGCACTTCTACATGTTGCTAAAGAA[C/T]AGYACAAACAAGCTGAGGAGAGGTGTGAAACTCCACATAYGCACACGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Nonsense 1433 1577 37 40
Genomic Location:
Chromosome 5 (position 52511376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGAGGTTTACCGCTCTCAGGGTCTGCTGGCTCAGGCCTCGGTGGCTTA[T/G]AAACAGAGTCTTCAGCTGGCCTCTCAGCTTGGGGACCACAGCGGCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100800 Essential Splice Site 1509 1577 38 40
Genomic Location:
Chromosome 5 (position 52507193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCCTTTTTCAAGCCTTACTGCAGTTCTCCGTGAAGATGGGYGCCAG[G/T]TAGARGACTTTAAAAATAGAGCTCTTTTGTGTTTSTGTTGTATTAATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ag9fhlm1