si:ch73-270f14.4

Ensembl ID:
ENSDARG00000074313
ZFIN ID:
ZDB-GENE-081104-5
Description:
Novel protein similar to vertebrate neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) [Source:U
Human Orthologue:
NTRK2
Human Description:
neurotrophic tyrosine kinase, receptor, type 2 [Source:HGNC Symbol;Acc:8032]
Mouse Orthologue:
Ntrk2
Mouse Description:
neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa39
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114940 Nonsense 223 238 6 6
ENSDART00000145594 Nonsense 223 385 6 8
Genomic Location (Zv9):
Chromosome 5 (position 57009452)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54961978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGATATGTAACGCATCAGGTTCCCCGACCCCAGAGCTCACTTGGACCT[T/G]AAATTCCAGCGAACACCCTCCTCTCTCAACCAGCCACGAGGTAACACTCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link