MAST2

Ensembl ID:
ENSDARG00000074311
Description:
microtubule associated serine/threonine kinase 2 [Source:HGNC Symbol;Acc:19035]
Human Orthologue:
MAST2
Human Description:
microtubule associated serine/threonine kinase 2 [Source:HGNC Symbol;Acc:19035]
Mouse Orthologue:
Mast2
Mouse Description:
microtubule associated serine/threonine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:894676]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20733 Nonsense Mutation detected in F1 DNA During 2014
sa489 Essential Splice Site Available for shipment Available now
sa7584 Missense Mutation detected in F1 DNA During 2014
sa11672 Essential Splice Site Available for shipment Available now
sa8985 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Nonsense 295 1934 10 30
Genomic Location:
Chromosome 6 (position 33382887)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCACCAATATCATTTGACCATGAGATTGTCATGATGAACCATGTCTA[C/A]AAGGAGCGTTTTCCTAAGGTGAGGTCTTAAACTGAAATACTAGATAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Essential Splice Site 301 1934 10 30
Genomic Location:
Chromosome 6 (position 33382868)
KASP Assay ID:
554-0342.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATGAGATTGTCATGATGAACCATGTCTACAAGGAGCGTTTTCCTAAG[G/A]TGAGGTCTTAAACTGAAATACTAGATAGATTATTTTAACAAAGTAATGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa7584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Missense 615 1934 17 30
Genomic Location:
Chromosome 6 (position 33371558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCACGCATGTACTTTGCTGAAACCGTTCTTGCATTGGAATACCTTCA[C/A]AACTATGGTATTGTGCACAGAGACCTCAAACCTGACAAGTAAGGAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Essential Splice Site 1059 1934 25 30
Genomic Location:
Chromosome 6 (position 33366666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATCAAATCAGCTTCAGCAACAACCCTGTCACTCATGATCCCTGCTGG[T/C]AAGTGTACAGTATATGATTGACCATCATGATTTTACAATRTAAGACATRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Nonsense 1127 1934 26 30
Genomic Location:
Chromosome 6 (position 33366257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTTACTTTACGTGCAATCCGGGTTTACATGGGAGACACAGACATATA[T/A]ACTGTCCATCACATGGTCTGGGTGAGTAGTACTGGGTSAATGTAGTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/owf0no5s