MAST2

Ensembl ID:
ENSDARG00000074311
Description:
microtubule associated serine/threonine kinase 2 [Source:HGNC Symbol;Acc:19035]
Human Orthologue:
MAST2
Human Description:
microtubule associated serine/threonine kinase 2 [Source:HGNC Symbol;Acc:19035]
Mouse Orthologue:
Mast2
Mouse Description:
microtubule associated serine/threonine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:894676]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33890 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20733 Nonsense Mutation detected in F1 DNA During 2016
sa489 Essential Splice Site Available for shipment Available now
sa7584 Missense Mutation detected in F1 DNA During 2016
sa40725 Nonsense Mutation detected in F1 DNA During 2016
sa40724 Nonsense Mutation detected in F1 DNA During 2016
sa11672 Essential Splice Site Available for shipment Available now
sa8985 Nonsense Mutation detected in F1 DNA During 2016
sa26773 Nonsense Mutation detected in F1 DNA During 2016
sa26772 Nonsense Mutation detected in F1 DNA During 2016
sa31517 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Essential Splice Site 276 1934 9 30
Genomic Location (Zv9):
Chromosome 6 (position 33388508)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33706173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGGGAGACGATCCCCAGCCATGCGTCCGCGCTCCCGCAGTCTCAGG[T/C]ACAAACACGTACACATTCCCATTTCACAGCAATCAGAAGCTGGCCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Nonsense 295 1934 10 30
Genomic Location (Zv9):
Chromosome 6 (position 33382887)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33700552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCACCAATATCATTTGACCATGAGATTGTCATGATGAACCATGTCTA[C/A]AAGGAGCGTTTTCCTAAGGTGAGGTCTTAAACTGAAATACTAGATAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Essential Splice Site 301 1934 10 30
Genomic Location (Zv9):
Chromosome 6 (position 33382868)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33700533
KASP Assay ID:
554-0342.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATGAGATTGTCATGATGAACCATGTCTACAAGGAGCGTTTTCCTAAG[G/A]TGAGGTCTTAAACTGAAATACTAGATAGATTATTTTAACAAAGTAATGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa7584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Missense 615 1934 17 30
Genomic Location (Zv9):
Chromosome 6 (position 33371558)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33689223
KASP Assay ID:
554-4157.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCACGCATGTACTTTGCTGAAACCGTTCTTGCATTGGAATACCTTCA[C/A]AACTATGGTATTGTGCACAGAGACCTCAAACCTGACAAGTAAGGAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Nonsense 766 1934 21 30
Genomic Location (Zv9):
Chromosome 6 (position 33369841)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33687506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATATTTAAAGAAATCTTCTCTTTTTATGTCTAACAGGGAGTGCGTTT[G/T]AGGTAAAACAGCACCGCTTCTTTACTGATCTGGACTGGAACAGCCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Nonsense 825 1934 22 30
Genomic Location (Zv9):
Chromosome 6 (position 33369523)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33687188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCATGTGGACTCAGAGGAAGAAGATGACACAAATGATGACGACCATT[T/A]GGAGATCCGTCAGTTCTCCTCCTGTTCGCCACGATTCAGCAAGGTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Essential Splice Site 1059 1934 25 30
Genomic Location (Zv9):
Chromosome 6 (position 33366666)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33684331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATCAAATCAGCTTCAGCAACAACCCTGTCACTCATGATCCCTGCTGG[T/C]AAGTGTACAGTATATGATTGACCATCATGATTTTACAATRTAAGACATRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Nonsense 1127 1934 26 30
Genomic Location (Zv9):
Chromosome 6 (position 33366257)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33683922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTTACTTTACGTGCAATCCGGGTTTACATGGGAGACACAGACATATA[T/A]ACTGTCCATCACATGGTCTGGGTGAGTAGTACTGGGTSAATGTAGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Nonsense 1402 1934 30 30
Genomic Location (Zv9):
Chromosome 6 (position 33364896)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33682561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGATATCTCGGCCAAAGAGTGCAGACCCTCCTCGCTCTCCTCTGCTC[A/T]AACGAGTCCAGTCCGCAGAGAAACTCGCCGCCTCTCTTTCTTCTTCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Nonsense 1403 1934 30 30
Genomic Location (Zv9):
Chromosome 6 (position 33364893)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33682558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATATCTCGGCCAAAGAGTGCAGACCCTCCTCGCTCTCCTCTGCTCAAA[C/T]GAGTCCAGTCCGCAGAGAAACTCGCCGCCTCTCTTTCTTCTTCATCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115409 Nonsense 1813 1934 30 30
Genomic Location (Zv9):
Chromosome 6 (position 33363663)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33681328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGCTCAATATCCCAGGTACTAAAGAGACCATGGAACGAACAAAGGAC[C/T]AGCGTACCCAGGCAGATGCCACCCACCCAAAGATAAAAGAATGTCGCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link