cnnm4

Ensembl ID:
ENSDARG00000074309
ZFIN ID:
ZDB-GENE-070705-181
Description:
Novel protein similar to human and mouse cyclin M4 (CNNM4) [Source:UniProtKB/TrEMBL;Acc:A5WWF8]
Human Orthologue:
CNNM4
Human Description:
cyclin M4 [Source:HGNC Symbol;Acc:105]
Mouse Orthologue:
Cnnm4
Mouse Description:
cyclin M4 Gene [Source:MGI Symbol;Acc:MGI:2151060]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13735 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114069 Essential Splice Site 763 769 None 8
ENSDART00000132406 None None 602 None 4

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 5 (position 14749197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGACCACCTCGCTCCTCAACGAACAGAACAGCCAACCTGCYCGCCAGG[C/T]CAACCACAACACACACAACGAGAGTGCCATATGACACRCTYTCACACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kcbhhfnw