si:ch211-286e11.2

Ensembl ID:
ENSDARG00000074308
ZFIN ID:
ZDB-GENE-081104-225
Description:
Novel protein similar to H.sapiens C22orf36, Leucine-rich repeat-containing protein C22orf36 (C22orf
Human Orthologue:
C22orf36
Human Description:
chromosome 22 open reading frame 36 [Source:HGNC Symbol;Acc:33155]
Mouse Orthologue:
AI646023
Mouse Description:
expressed sequence AI646023 Gene [Source:MGI Symbol;Acc:MGI:2143657]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34460 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111506 Nonsense 307 356 5 6
ENSDART00000138036   None 171 None 3
Genomic Location (Zv9):
Chromosome 8 (position 42114532)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40129305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCCTGCGGCGACGCTGTAGCCTAAAGAGCAGTTTGCCCACCATCTA[C/A]GAGTACACCGAGGGTCAGCCCTACTGCTACCGCATGGAGAGCTCCATTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Liver enzyme levels: Population-based genome-wide association studies reveal six loci influencing plasma levels of liver enzymes. (View Study)
  • Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link