PHF12 (1 of 2)

Ensembl ID:
ENSDARG00000074303
Description:
PHD finger protein 12 [Source:HGNC Symbol;Acc:20816]
Human Orthologue:
PHF12
Human Description:
PHD finger protein 12 [Source:HGNC Symbol;Acc:20816]
Mouse Orthologue:
Phf12
Mouse Description:
PHD finger protein 12 Gene [Source:MGI Symbol;Acc:MGI:1924057]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31794 Essential Splice Site Available for shipment Available now
sa1613 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111104 Essential Splice Site 83 941 2 15
Genomic Location (Zv9):
Chromosome 10 (position 38158526)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36881336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGCTGTGCTGTGATCACTGTCCTGCTGCTTTCCATCTACAGTGCTG[G/A]TGTGTTAGATTCTGGAGCTGTTTAAGCCACTACTGTTGGTCAGGTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111104 Nonsense 539 941 9 15
Genomic Location (Zv9):
Chromosome 10 (position 38150795)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36873702
KASP Assay ID:
554-1554.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATCCTGTTAGAACCCAAAACAAGAGCGCTGACCGTGAAAAGCCTTGTT[T/A]ACCCATGCCCAGTCCACYCAACCATGCCAACTCTGGAGCCATTATCAAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link