cth

Ensembl ID:
ENSDARG00000074301
ZFIN ID:
ZDB-GENE-030131-774
Description:
cystathionase (cystathionine gamma-lyase) [Source:RefSeq peptide;Acc:NP_997769]
Human Orthologue:
CTH
Human Description:
cystathionase (cystathionine gamma-lyase) [Source:HGNC Symbol;Acc:2501]
Mouse Orthologue:
Cth
Mouse Description:
cystathionase (cystathionine gamma-lyase) Gene [Source:MGI Symbol;Acc:MGI:1339968]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8236 Nonsense Mutation detected in F1 DNA During 2014
sa20749 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104207 Nonsense 170 400 5 12
ENSDART00000138351 Nonsense 154 378 5 12
Genomic Location:
Chromosome 6 (position 37368300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGAAACACCCACAAACCCWACAATGAAGGTTGTKGACATCCAGGCCTG[T/A]GCAGATATTGTCCATAAGCACAACAAGGACACAATCGTTGTTGTGGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104207 Essential Splice Site 215 400 6 12
ENSDART00000138351 Essential Splice Site 199 378 6 12
Genomic Location:
Chromosome 6 (position 37367916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTTGGAGCAGACATCTGCATGTACTCTGCAACAAAATACATGAATGG[T/A]AAAAAAGTTACATATAAACCTTTGACACAATTGAAATACAGATGAGCGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ohm2q64n