tuba4l

Ensembl ID:
ENSDARG00000074289
ZFIN ID:
ZDB-GENE-030131-5588
Description:
tubulin, alpha 4 like [Source:RefSeq peptide;Acc:NP_956089]
Human Orthologues:
TUBA4A, TUBA8
Human Descriptions:
tubulin, alpha 4a [Source:HGNC Symbol;Acc:12407]
tubulin, alpha 8 [Source:HGNC Symbol;Acc:12410]
Mouse Orthologues:
Tuba4a, Tuba8
Mouse Descriptions:
tubulin, alpha 4A Gene [Source:MGI Symbol;Acc:MGI:1095410]
tubulin, alpha 8 Gene [Source:MGI Symbol;Acc:MGI:1858225]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4487 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa4487
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115157 Essential Splice Site 124 449 3 4
Genomic Location:
Chromosome 13 (position 6287916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTGGAAAGGAGATYGTAGACTCTGTGCTTGATCGCATGCGCAAAATG[G/A]TGAGTTTGCACACTTGAATWATGGTTCTTMATTAGTAACAATTATTGYGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/twqx9hnk