si:ch73-194h10.1

Ensembl ID:
ENSDARG00000074283
ZFIN ID:
ZDB-GENE-100922-30
Human Orthologue:
INPP5D
Human Description:
inositol polyphosphate-5-phosphatase, 145kDa [Source:HGNC Symbol;Acc:6079]
Mouse Orthologue:
Inpp5d
Mouse Description:
inositol polyphosphate-5-phosphatase D Gene [Source:MGI Symbol;Acc:MGI:107357]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18179 Nonsense Available for shipment Available now
sa40704 Nonsense Mutation detected in F1 DNA During 2017
sa40705 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113405 Nonsense 362 1108 10 27
ENSDART00000137907 Nonsense 372 835 10 23

The following transcripts of ENSDARG00000074283 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 27870551)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28171762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGTCACAGAAGATGCACAACAGACTTGTATTGGTGGTAGAGACAGAG[A/T]AAGGAAAAACTCAGAGCAAAGACTTTGTCTTTGAWGACACAAAGGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113405 Nonsense 449 1108 12 27
ENSDART00000137907 Nonsense 459 835 12 23

The following transcripts of ENSDARG00000074283 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 27871552)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28172763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGATGACACAGCCAATCAAATCCCACATGACATCTACGTAATCGGGACA[C/T]AGGAGGACCCACTGGGAGAGAAAGAGTGGATTGAGACAATTAGAGGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113405 Nonsense 952 1108 26 27
ENSDART00000137907   None 835 None 23

The following transcripts of ENSDARG00000074283 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 27898648)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28199859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAATATGCTAAACTCAATCTTATTCTTGCTTTTAGACCTGTGGACGGT[C/T]AACCACCAGAGATGTTTGACAATCCTCTTTATGGCTCAATGAGTGGATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link