LOC100332784

Ensembl ID:
ENSDARG00000074282

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32595 Nonsense Available for shipment Available now
sa32594 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12177 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110790 Nonsense 213 956 2 19
Genomic Location (Zv9):
Chromosome 1 (position 8596908)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8836713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATATTCCTGTTTCTCATACAGATAACAGACCCGACTGAAAAGAGGTA[C/A]GAGGTGCCTATAGATGTCCCTGTGGTTCATAAAAGAGCCTCAAACCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110790 Essential Splice Site 501 956 8 19
Genomic Location (Zv9):
Chromosome 1 (position 8590120)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8829925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGGCATCTTCATCAATGACTCAAATGGAGACATCCTTATTGGAAAGG[T/C]ACACAAATCTAAGCTTTTTCTGATCAAAAATAGAGTAAAAACGGTAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110790 Nonsense 877 956 17 19
Genomic Location (Zv9):
Chromosome 1 (position 8581539)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8821344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATCTGTACTGGGATGATGGAGAGACCATTGASTCGTATGARAGCAAT[C/T]AATACGCTTACATCTATTTCACAGTAGAACAGGTACTGAAAACAGCCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link