si:ch211-157h5.2

Ensembl ID:
ENSDARG00000074275
ZFIN ID:
ZDB-GENE-090312-153
Description:
hypothetical protein LOC561940 [Source:RefSeq peptide;Acc:NP_001139049]
Human Orthologue:
LIMCH1
Human Description:
LIM and calponin homology domains 1 [Source:HGNC Symbol;Acc:29191]
Mouse Orthologue:
Limch1
Mouse Description:
LIM and calponin homology domains 1 Gene [Source:MGI Symbol;Acc:MGI:1924819]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16015 Essential Splice Site Available for shipment Available now
sa31201 Essential Splice Site Available for shipment Available now
sa15501 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113023 Essential Splice Site 368 1660 9 25
ENSDART00000126770   None 319 None 9
ENSDART00000132379   None 1019 None 22

The following transcripts of ENSDARG00000074275 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17749683)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18314851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAAAAGCGGGAATTAAAGTGTTMCCCGCCGCTGTTCGATACAACAGG[T/A]CTGCGGTTGCAATGATAATATATATATTTAGCATGCGTCTGACTAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113023   None 1660 None 25
ENSDART00000126770 Essential Splice Site 175 319 4 9
ENSDART00000132379 Essential Splice Site 875 1019 17 22

The following transcripts of ENSDARG00000074275 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17802223)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18367391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCAGGAGAGCCAGATCACAGCTACACCACAACTGCAGTTCATACAGG[G/A]TAAGACATGCACATATAAATCTCAAAGGGTTTCAATAGTAAACGGATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113023   None 1660 None 25
ENSDART00000126770 Nonsense 181 319 5 9
ENSDART00000132379 Nonsense 881 1019 18 22

The following transcripts of ENSDARG00000074275 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17803342)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18368510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGATTTCTCTGTYTCCCTGTGTGTTTTACAGATGGCTCGTGGAGCTG[C/A]AAGTCTAAAGGCAGGCAGGAGGATCTGAAGAAAACCGCYTCGCTGGATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link