LOC100330660

Ensembl ID:
ENSDARG00000074266
Human Orthologue:
C7orf55
Human Description:
chromosome 7 open reading frame 55 [Source:HGNC Symbol;Acc:26946]
Mouse Orthologue:
1110001J03Rik
Mouse Description:
RIKEN cDNA 1110001J03 gene Gene [Source:MGI Symbol;Acc:MGI:1913367]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11748 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053892 Nonsense 40 112 1 2
Genomic Location:
Chromosome 3 (position 2004319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGGGCTCCGGTTACCGACACTCTCCCGTTTAYCAGTATGTGCTGCAG[C/T]AGTTCCGGAAAAACCAGGTAACGGCGACGACTGCGCATGAGCGATAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jfi7dfti