LOC100332318

Ensembl ID:
ENSDARG00000074258
Human Orthologue:
GRAMD1B
Human Description:
GRAM domain containing 1B [Source:HGNC Symbol;Acc:29214]
Mouse Orthologue:
Gramd1b
Mouse Description:
GRAM domain containing 1B Gene [Source:MGI Symbol;Acc:MGI:1925037]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23383 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32222 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23382 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108574 Essential Splice Site 86 748 3 20
Genomic Location (Zv9):
Chromosome 18 (position 45280555)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46873398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTGTTTTCCATCTCTTTCTCTTGCAGAAAAGCCAGAGCTGGTACAAC[G/T]TAAGTCACACCATTTCTATTTATAATTGTGTGTGTGTGTATACGTGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108574 Essential Splice Site 305 748 9 20
Genomic Location (Zv9):
Chromosome 18 (position 45262809)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46855652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCATCACCTCCACCACTCCACCCAGCAGCACCGATACACCGCTGTCCG[T/C]GAGTCTAAGAGCTCATGCTTGCTTTCTACATCTCCTTTTGTTGTTGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108574 Nonsense 655 748 18 20
Genomic Location (Zv9):
Chromosome 18 (position 45253033)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46845876
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCCGGCAGTCTGGTGCTACTGGTGTTTCTGAATGTGATGCTGTTTTA[T/A]AAACTCTGGATGCTGGAGTATTCTGCACAGAGCCTCACCAGCTGGCAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link