EFHA2 (2 of 2)

Ensembl ID:
ENSDARG00000074255
Description:
EF-hand domain family, member A2 [Source:HGNC Symbol;Acc:27820]
Human Orthologue:
EFHA2
Human Description:
EF-hand domain family, member A2 [Source:HGNC Symbol;Acc:27820]
Mouse Orthologue:
Efha2
Mouse Description:
EF-hand domain family, member A2 Gene [Source:MGI Symbol;Acc:MGI:1925756]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6347 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8466 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087859 Essential Splice Site 214 438 6 12
Genomic Location:
Chromosome 14 (position 31344058)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGATGCGGACGGCAATCAAATGGTGGATAAGAGGGAGTTCATGGTGG[T/C]ATGGCTGTTTTTCTGCCRATGTTTTATTATTAATCTGAATGTCAGCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8466
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087859 Essential Splice Site 239 438 7 12
Genomic Location:
Chromosome 14 (position 31343899)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAGAGAAAGGAGCGAGGAGGAGATGCTGAGAGWTCATCTCAGCTGG[T/C]AAGAAAAACTGGTWCKTCATTTTCAATGTATTTTATTTACAGTCCTRAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c1bj6m2l