als2cr4b

Ensembl ID:
ENSDARG00000074248
ZFIN ID:
ZDB-GENE-040912-63
Description:
hypothetical protein LOC447898 [Source:RefSeq peptide;Acc:NP_001004636]
Human Orthologue:
ALS2CR4
Human Description:
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 [Source:HGNC Symbol;Acc:14
Mouse Orthologue:
Als2cr4
Mouse Description:
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 Gene [Source:MGI Symbol;Ac

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3595 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005573 Nonsense 254 413 10 14
Genomic Location:
Chromosome 6 (position 7815610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCATGGTTTTCTGGCTGGTTATGCGGTGTGGAACATCATAGTGGTGTA[T/A]GTGTTGGCAGGGGATCAGATGAGCTCTCTGTCTAAYCTGCWGCAGCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h6806d67