arhgef10l

Ensembl ID:
ENSDARG00000074244
ZFIN ID:
ZDB-GENE-090313-222
Human Orthologue:
ARHGEF10L
Human Description:
Rho guanine nucleotide exchange factor (GEF) 10-like [Source:HGNC Symbol;Acc:25540]
Mouse Orthologue:
Arhgef10l
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 10-like Gene [Source:MGI Symbol;Acc:MGI:1920004]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11315 Nonsense Available for shipment Available now
sa8647 Nonsense Mutation detected in F1 DNA During 2018
sa43970 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa8886 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11484 Essential Splice Site Available for shipment Available now
sa45796 Nonsense Mutation detected in F1 DNA During 2018
sa1355 Nonsense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa11315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Nonsense 135 1297 4 27
ENSDART00000134741   None 1037 None 20
ENSDART00000140253 Nonsense 176 289 4 7
Genomic Location (Zv9):
Chromosome 23 (position 21846641)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21625948
GRCz11 23 21552499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTGTTTYAGGAGTTCTGTTTCGATTGAGCCTCGAGCAGCCGAAGAA[C/T]AAACCMCCATTTTGAAAAGAAATATMATTTATGAAGGTAATACATGMRGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Nonsense 442 1297 12 27
ENSDART00000134741 Nonsense 170 1037 5 20
ENSDART00000140253   None 289 None 7
Genomic Location (Zv9):
Chromosome 23 (position 21864604)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21643911
GRCz11 23 21570462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCCCTTCAGTTTTCYAAGTCAATGGTGCTAGACGTCTACAGCGACTA[T/A]GTCAACAACTTCACCAATGCTATGGCCCTTATCAAGAAAGCCTGTATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Essential Splice Site 605 1297 16 27
ENSDART00000134741 Missense 345 1037 9 20
ENSDART00000140253   None 289 None 7
Genomic Location (Zv9):
Chromosome 23 (position 21879051)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21658358
GRCz11 23 21584909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGTTATTTTGAGTTCGGGTCTTCAGTTAATTGTTGTGTGTTTATTCA[G/A]GGGGCCTCCGGATATCAGCAGCCTCGTCCCCATTGGCCCCAAGTATGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Essential Splice Site 778 1297 19 27
ENSDART00000134741 Essential Splice Site 518 1037 12 20
ENSDART00000140253   None 289 None 7
ENSDART00000111966 Essential Splice Site 778 1297 19 27
ENSDART00000134741 Essential Splice Site 518 1037 12 20
ENSDART00000140253   None 289 None 7
Genomic Location (Zv9):
Chromosome 23 (position 21891434)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21670741
GRCz11 23 21597292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAAATCTCCTGGGTTAATCGTCTGCATCTGGCCAAAATCGCCCTGAG[T/A]AAGTGTGTCCTCTCAGATATGACTAACAGTTGTTGACATGAATCTTTCAM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Essential Splice Site 778 1297 19 27
ENSDART00000134741 Essential Splice Site 518 1037 12 20
ENSDART00000140253   None 289 None 7
ENSDART00000111966 Essential Splice Site 778 1297 19 27
ENSDART00000134741 Essential Splice Site 518 1037 12 20
ENSDART00000140253   None 289 None 7
Genomic Location (Zv9):
Chromosome 23 (position 21891434)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21670741
GRCz11 23 21597292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAAATCTCCTGGGTTAATCGTCTGCATCTGGCCAAAATCGCCCTGAG[T/A]AAGTGTGTCCTCTCAGATATGACTAACAGTTGTTGACATGAATCTTTCAM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Nonsense 824 1297 21 27
ENSDART00000134741 Nonsense 564 1037 14 20
ENSDART00000140253   None 289 None 7
Genomic Location (Zv9):
Chromosome 23 (position 21912148)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21691455
GRCz11 23 21618006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAAAAGTGATCTCTTCTCTTTTTCTTGCAGTTGCAGGCTGCCCTGTA[T/A]AACCCAGTCCACTGTGCTCTTCTTGGTTTTTCTGCTGCCAGCACATCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1355
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Nonsense 1280 1297 27 27
ENSDART00000134741 Nonsense 1020 1037 20 20
ENSDART00000140253   None 289 None 7
Genomic Location (Zv9):
Chromosome 23 (position 21925141)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21704448
GRCz11 23 21630999
KASP Assay ID:
554-1269.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTATATCCGGTGGAAAAGGGTTYCGTCGCTTAGCTAATTCCTCACACT[C/A]GGCAGAGTCCAGTGAAAATACGCTGATGGTCTGGCAGCTGCCCATTACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link