arhgef10l

Ensembl ID:
ENSDARG00000074244
ZFIN ID:
ZDB-GENE-090313-222
Human Orthologue:
ARHGEF10L
Human Description:
Rho guanine nucleotide exchange factor (GEF) 10-like [Source:HGNC Symbol;Acc:25540]
Mouse Orthologue:
Arhgef10l
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 10-like Gene [Source:MGI Symbol;Acc:MGI:1920004]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11315 Nonsense Available for shipment Available now
sa8647 Nonsense Mutation detected in F1 DNA During 2014
sa11484 Essential Splice Site Available for shipment Available now
sa8886 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1355 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa11315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Nonsense 135 1297 4 27
ENSDART00000134741 None None 1037 None 20
ENSDART00000140253 Nonsense 176 289 4 7
Genomic Location:
Chromosome 23 (position 21846641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTGTTTYAGGAGTTCTGTTTCGATTGAGCCTCGAGCAGCCGAAGAA[C/T]AAACCMCCATTTTGAAAAGAAATATMATTTATGAAGGTAATACATGMRGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Nonsense 442 1297 12 27
ENSDART00000134741 Nonsense 170 1037 5 20
ENSDART00000140253 None None 289 None 7
Genomic Location:
Chromosome 23 (position 21864604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCCCTTCAGTTTTCYAAGTCAATGGTGCTAGACGTCTACAGCGACTA[T/A]GTCAACAACTTCACCAATGCTATGGCCCTTATCAAGAAAGCCTGTATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Essential Splice Site 778 1297 19 27
ENSDART00000134741 Essential Splice Site 518 1037 12 20
ENSDART00000140253 None None 289 None 7
ENSDART00000111966 Essential Splice Site 778 1297 19 27
ENSDART00000134741 Essential Splice Site 518 1037 12 20
ENSDART00000140253 None None 289 None 7
Genomic Location:
Chromosome 23 (position 21891434)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAAATCTCCTGGGTTAATCGTCTGCATCTGGCCAAAATCGCCCTGAG[T/A]AAGTGTGTCCTCTCAGATATGACTAACAGTTGTTGACATGAATCTTTCAM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Essential Splice Site 778 1297 19 27
ENSDART00000134741 Essential Splice Site 518 1037 12 20
ENSDART00000140253 None None 289 None 7
ENSDART00000111966 Essential Splice Site 778 1297 19 27
ENSDART00000134741 Essential Splice Site 518 1037 12 20
ENSDART00000140253 None None 289 None 7
Genomic Location:
Chromosome 23 (position 21891434)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAAATCTCCTGGGTTAATCGTCTGCATCTGGCCAAAATCGCCCTGAG[T/A]AAGTGTGTCCTCTCAGATATGACTAACAGTTGTTGACATGAATCTTTCAM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1355
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111966 Nonsense 1280 1297 27 27
ENSDART00000134741 Nonsense 1020 1037 20 20
ENSDART00000140253 None None 289 None 7
Genomic Location:
Chromosome 23 (position 21925141)
KASP Assay ID:
554-1269.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTATATCCGGTGGAAAAGGGTTYCGTCGCTTAGCTAATTCCTCACACT[C/A]GGCAGAGTCCAGTGAAAATACGCTGATGGTCTGGCAGCTGCCCATTACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gfwq1fnd