pde4bb

Ensembl ID:
ENSDARG00000074233
ZFIN ID:
ZDB-GENE-070912-454
Description:
Novel protein similar to phosphodiesterase 4, cAMP specific family [Source:UniProtKB/TrEMBL;Acc:B0V3
Human Orthologue:
PDE4B
Human Description:
phosphodiesterase 4B, cAMP-specific [Source:HGNC Symbol;Acc:8781]
Mouse Orthologue:
Pde4b
Mouse Description:
phosphodiesterase 4B, cAMP specific Gene [Source:MGI Symbol;Acc:MGI:99557]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19698 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085631 Nonsense 278 609 8 14
ENSDART00000133765   None 276 None 8
Genomic Location (Zv9):
Chromosome 2 (position 13926061)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14787014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAAGTGGCAGAGCACTCGCACCACCGCCCACTAGCCTGCATCATGTA[T/A]GCCATCTTTCAGGTTTGTGCACAAAAAAGCTTATCTAACAAGTCTAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link