PRR12 (2 of 2)

Ensembl ID:
ENSDARG00000074229
Description:
proline rich 12 [Source:HGNC Symbol;Acc:29217]
Human Orthologue:
PRR12
Human Description:
proline rich 12 [Source:HGNC Symbol;Acc:29217]
Mouse Orthologue:
Prr12
Mouse Description:
proline rich 12 Gene [Source:MGI Symbol;Acc:MGI:2679002]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22012 Nonsense Available for shipment Available now
sa22013 Nonsense Available for shipment Available now
sa10141 Nonsense Available for shipment Available now
sa22014 Nonsense Available for shipment Available now
sa11454 Nonsense Available for shipment Available now
sa17820 Essential Splice Site Available for shipment Available now
sa17587 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110514 Nonsense 387 2532 4 15
Genomic Location (Zv9):
Chromosome 12 (position 5357524)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4586740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGACCGATAACACAGCCATCCTATGGGTCCTCCTCATCCTCATCCACT[G/T]GAGGGGCAGGAAAGGGGACAAAGAGCAGTTCCAGTAGTGGTTACTCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110514 Nonsense 457 2532 4 15
Genomic Location (Zv9):
Chromosome 12 (position 5357734)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4586530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTAATTCCATTCCAACCTCCACTTCTGCCTCTGCATCTTCTCGCCAA[C/T]AGCCACCAACACAGTCTGTACCCCCACCACCACAGTCACATTCCCAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110514 Nonsense 900 2532 4 15
Genomic Location (Zv9):
Chromosome 12 (position 5359063)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4585201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGATTCTCTGGGATCAGTAGTGCATTATGGGCGTGGTGACCCATATTCC[C/T]AWCACTCCATTCCTCAACACTCCACCTCCCACCATCAACACACTCCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110514 Nonsense 982 2532 4 15
Genomic Location (Zv9):
Chromosome 12 (position 5359309)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4584955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGCATCATCAGACTCATCCCCAACAACATCAACAACAACCGCAGCAA[C/T]AACAGCACCACTCTCAGTCACAGTCACTTATGGACTCTCCCACTGACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110514 Nonsense 1539 2532 4 15
Genomic Location (Zv9):
Chromosome 12 (position 5360980)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4583284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCCTTGGTCCCCCTCCTCAGCTATTGCCACAGGATGGACCGAAGAAA[C/T]GAGGCAGGAAGCCCACAAAGCCTAAACGAGAAGGACCTCCAAGGCCACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110514 Essential Splice Site 2339 2532 10 15
Genomic Location (Zv9):
Chromosome 12 (position 5368211)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4576053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTGCCCTCGTCATCAGAGTCRGACTCTTCAGCAAGYGAGGATGAAAG[T/A]GAGTAGATGAGTCAGCGTGGCATGCAGCATGTAGGGCAGTTTCAGCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110514 Essential Splice Site 2380 2532 12 15
Genomic Location (Zv9):
Chromosome 12 (position 5370061)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4574203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAACACGRGCCCAAATTCACCCTTCCTCTTGTATTATYACCCATTTC[A/T]GATGAGTTGTATCTTCCTCCAATGCGSAAGATCGACAGCATTMTCAGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link