si:ch211-269e2.1

Ensembl ID:
ENSDARG00000074225
ZFIN ID:
ZDB-GENE-070912-267
Description:
Novel protein similar to vertebrate stromal antigen 1 family [Source:UniProtKB/TrEMBL;Acc:B0S5T4]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1876 Nonsense Available for shipment Available now
sa34689 Nonsense Mutation detected in F1 DNA During 2017
sa9688 Splice Site, Nonsense Available for shipment Available now
sa18953 Nonsense Mutation detected in F1 DNA During 2017
sa9338 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112941 Nonsense 537 1174 15 31
ENSDART00000137416 Nonsense 537 1174 16 32
Genomic Location (Zv9):
Chromosome 9 (position 35421239)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34640750
KASP Assay ID:
554-1866.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGACTGGTCTTACCTCACTACTCTTACCTCACACGTCCTGTCAGGAT[C/T]AAGGCTAGTACACTACACTATACATGCCAGTACACTTCTTCACCAGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112941 Nonsense 586 1174 17 31
ENSDART00000137416 Nonsense 586 1174 18 32
Genomic Location (Zv9):
Chromosome 9 (position 35422263)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34641774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTTAGGTGATAAGCACTAAAGAGAAAAAATTACAAACTGATGACTG[C/A]GCCAAACTCACTGAACACTTCATTAAAGCGCTACCTGGGCTGTTATCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112941 Splice Site, Nonsense 632 1174 18 31
ENSDART00000137416 Splice Site, Nonsense 632 1174 19 32
Genomic Location (Zv9):
Chromosome 9 (position 35422483)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34641994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGAATACCTCRGTATTTCCAAATGGACACCTGTGAKCMTGAAAACTCA[C/T]AGGTGAGTRAGTGTTATTGTTTCATCTAATGCTATGATGCACTAAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112941 Nonsense 904 1174 25 31
ENSDART00000137416 Nonsense 904 1174 26 32
ENSDART00000112941 Nonsense 904 1174 25 31
ENSDART00000137416 Nonsense 904 1174 26 32
Genomic Location (Zv9):
Chromosome 9 (position 35437565)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34657076
KASP Assay ID:
2260-2125.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCAGGAATCTTCTGTCGGCGTACTGTAAGCTCATAGTGCACAGTGTGT[T/A]AGAGATGAGCATGGCTGCAGAGGTTTTCAAGCAGTACGTGAAGGTATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112941 Nonsense 904 1174 25 31
ENSDART00000137416 Nonsense 904 1174 26 32
ENSDART00000112941 Nonsense 904 1174 25 31
ENSDART00000137416 Nonsense 904 1174 26 32
Genomic Location (Zv9):
Chromosome 9 (position 35437565)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34657076
KASP Assay ID:
2260-2125.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYGCAGGAATCTTCTGTCKGCGTACTGTAAGCTCATAGTGCACAGTGTGT[T/A]AGAGATGAGCATGGCTGCAGAGGTTTTCAAGCAGTACGTGAAGGTATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link