flna

Ensembl ID:
ENSDARG00000074201
ZFIN ID:
ZDB-GENE-030131-2145
Human Orthologue:
FLNA
Human Description:
filamin A, alpha [Source:HGNC Symbol;Acc:3754]
Mouse Orthologue:
Flna
Mouse Description:
filamin, alpha Gene [Source:MGI Symbol;Acc:MGI:95556]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17303 Essential Splice Site Available for shipment Available now
sa24296 Nonsense Mutation detected in F1 DNA During 2014
sa24297 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24298 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Essential Splice Site 891 2614 16 47
ENSDART00000135820 Essential Splice Site 891 2553 16 46
ENSDART00000142228 None None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20075148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGATGCAAGCAAGGTTAAAGCTGAGGGGCCTGGACTTAGCCGTTCTGG[T/A]AAGATAATGGACACAAAACTAACTTGTGCGTCCCTGCTTAKAATGATGGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Nonsense 1294 2614 22 47
ENSDART00000135820 Nonsense 1236 2553 21 46
ENSDART00000142228 None None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20077163)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATCCGAGATCTGGGAGACGGCACATATCAAGTGGAGTACACGCCTTA[T/G]GAGGAGGGTGAGTGTTAGGGCTGTTTCTGTTTCAACTTAACATGATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Essential Splice Site 1296 2614 22 47
ENSDART00000135820 Essential Splice Site 1238 2553 21 46
ENSDART00000142228 None None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20077171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCTGGGAGACGGCACATATCAAGTGGAGTACACGCCTTATGAGGAGG[G/A]TGAGTGTTAGGGCTGTTTCTGTTTCAACTTAACATGATTAAAAAAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Splice Site 2270 2614 41 47
ENSDART00000135820 Essential Splice Site 2210 2553 None 46
ENSDART00000142228 None None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20090248)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGTAAAGATGGATCCAGTGGTGTCTCTTACATCGTCCAGGAGCCTGG[T/C]AAGGTTTTCCTTTTTTTAATTGTTTTTATTTATTTATTTTTTTACTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zc86sdhm