flna

Ensembl ID:
ENSDARG00000074201
ZFIN ID:
ZDB-GENE-030131-2145
Human Orthologue:
FLNA
Human Description:
filamin A, alpha [Source:HGNC Symbol;Acc:3754]
Mouse Orthologue:
Flna
Mouse Description:
filamin, alpha Gene [Source:MGI Symbol;Acc:MGI:95556]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43949 Nonsense Mutation detected in F1 DNA During 2016
sa43950 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43951 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17303 Essential Splice Site Available for shipment Available now
sa24296 Nonsense Mutation detected in F1 DNA During 2016
sa24297 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32439 Nonsense Mutation detected in F1 DNA During 2016
sa24298 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Nonsense 349 2614 5 47
ENSDART00000135820 Nonsense 349 2553 5 46
ENSDART00000142228   None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20065182)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19850289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAAGTCACAGCCAACAATGACAAGAACCGCACCTACTCAGTATTCTA[T/G]GTGCCAAAAGTCACTGGACAACACAAGGTACCCAGAACTGTTTGTATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Essential Splice Site 358 2614 5 47
ENSDART00000135820 Essential Splice Site 358 2553 5 46
ENSDART00000142228   None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20065210)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19850317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCACCTACTCAGTATTCTATGTGCCAAAAGTCACTGGACAACACAAG[G/A]TACCCAGAACTGTTTGTATAAGTTAGCGATTGAATGGGTTGAAATGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Essential Splice Site 526 2614 8 47
ENSDART00000135820 Essential Splice Site 526 2553 8 46
ENSDART00000142228   None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20070757)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19855864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAAGGAGCAGGAACCGGAGACCTCAAAGTTACCATCAAAGGGCCCAG[T/C]GAGTGGACGTCTATATTAATGCTGCAGTGCTAGATGATTTATCATGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Essential Splice Site 891 2614 16 47
ENSDART00000135820 Essential Splice Site 891 2553 16 46
ENSDART00000142228   None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20075148)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19860255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGATGCAAGCAAGGTTAAAGCTGAGGGGCCTGGACTTAGCCGTTCTGG[T/A]AAGATAATGGACACAAAACTAACTTGTGCGTCCCTGCTTAKAATGATGGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Nonsense 1294 2614 22 47
ENSDART00000135820 Nonsense 1236 2553 21 46
ENSDART00000142228   None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20077163)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19862270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATCCGAGATCTGGGAGACGGCACATATCAAGTGGAGTACACGCCTTA[T/G]GAGGAGGGTGAGTGTTAGGGCTGTTTCTGTTTCAACTTAACATGATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Essential Splice Site 1296 2614 22 47
ENSDART00000135820 Essential Splice Site 1238 2553 21 46
ENSDART00000142228   None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20077171)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19862278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCTGGGAGACGGCACATATCAAGTGGAGTACACGCCTTATGAGGAGG[G/A]TGAGTGTTAGGGCTGTTTCTGTTTCAACTTAACATGATTAAAAAAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Nonsense 1813 2614 33 47
ENSDART00000135820 Nonsense 1753 2553 32 46
ENSDART00000142228   None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20087028)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19872135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAATATGCCCCAACTGAGGCGGGCCTGCATGAGATGGACATTAAATA[T/A]GATGGAATACACATTCCAGGTAAAAGACATGTATTCTCAATGTACAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073442 Splice Site 2270 2614 41 47
ENSDART00000135820 Essential Splice Site 2210 2553 None 46
ENSDART00000142228   None 353 None 7

The following transcripts of ENSDARG00000074201 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20090248)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19875355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGTAAAGATGGATCCAGTGGTGTCTCTTACATCGTCCAGGAGCCTGG[T/C]AAGGTTTTCCTTTTTTTAATTGTTTTTATTTATTTATTTTTTTACTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link