TOB2

Ensembl ID:
ENSDARG00000074195
Description:
transducer of ERBB2, 2 [Source:HGNC Symbol;Acc:11980]
Human Orthologue:
TOB2
Human Description:
transducer of ERBB2, 2 [Source:HGNC Symbol;Acc:11980]
Mouse Orthologue:
Tob2
Mouse Description:
transducer of ERBB2, 2 Gene [Source:MGI Symbol;Acc:MGI:1888525]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15324 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115007 Nonsense 308 339 3 3
Genomic Location:
Chromosome 3 (position 5677303)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCAGTCCACCKCCAGGTCAGGCCGTCGGAATCATTGGAAGCAACAGT[G/T]GAATTTCATTCATGGACAAATCACCATTTGTGGAAGGACTGGGATACAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Vitiligo: Genome-wide association analyses identify 13 new susceptibility loci for generalized vitiligo. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/olci0637